BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_K208024 1 BBa_K208024 HlyA Signal Peptide/Terminator 2009-10-19T11:00:00Z 2015-05-08T01:11:24Z Composite PelB false false _310_ 0 3473 9 It's complicated false Silver false USU iGEM 2009 component2056734 1 BBa_B0010 component2056733 1 BBa_K208006 component2056736 1 BBa_B0012 annotation2056736 1 BBa_B0012 range2056736 1 283 323 annotation2056733 1 BBa_K208006 range2056733 1 1 186 annotation2056734 1 BBa_B0010 range2056734 1 195 274 BBa_K208006 1 BBa_K208006 HlyA Signal Peptide - Silver Fusion Compatible 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z Synthetic Released HQ 2013 HlyA false true _310_ 0 3473 9 In stock false Silver Fusion false USU iGEM 2009 annotation2062223 1 Start range2062223 1 1 3 annotation2034624 1 HlyA range2034624 1 1 186 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K208006_sequence 1 ttagcctatggaagtcagggtgatcttaatccattaattaatgaaatcagcaaaatcatttcagcagcaggtagcttcgatgttaaagaggaaagaaccgcagcttctttattgcagttgtccggtaatgccagtgatttttcatatggacggaactcaataaccctgaccacatcagcataataa BBa_K208024_sequence 1 ttagcctatggaagtcagggtgatcttaatccattaattaatgaaatcagcaaaatcatttcagcagcaggtagcttcgatgttaaagaggaaagaaccgcagcttctttattgcagttgtccggtaatgccagtgatttttcatatggacggaactcaataaccctgaccacatcagcataataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z