BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K208002 1 BBa_K208002 Gene III Signal Peptide - Silver Fusion Compatible 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z pBAD GeneIII false false _310_ 0 3473 9 It's complicated false Silver Fusion false USU iGEM 2009 annotation2062220 1 Start range2062220 1 1 3 annotation2034603 1 Gene III range2034603 1 1 54 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K208038 1 BBa_K208038 Lac Promoter/RBS/GeneIII/PhaP/Terminator 2009-10-19T11:00:00Z 2015-05-08T01:11:24Z Composite PhaP Secretion false false _310_ 0 3473 9 It's complicated true Silver Fusion false USU iGEM 2009 component2056085 1 BBa_B0012 component2056079 1 BBa_B0034 component2056082 1 BBa_K208001 component2056081 1 BBa_K208002 component2056071 1 BBa_R0010 component2056083 1 BBa_B0010 annotation2056081 1 BBa_K208002 range2056081 1 227 280 annotation2056082 1 BBa_K208001 range2056082 1 287 865 annotation2056079 1 BBa_B0034 range2056079 1 209 220 annotation2056085 1 BBa_B0012 range2056085 1 962 1002 annotation2056083 1 BBa_B0010 range2056083 1 874 953 annotation2056071 1 BBa_R0010 range2056071 1 1 200 BBa_K208001 1 BBa_K208001 Phasin (PhaP) 2009-10-07T11:00:00Z 2015-05-08T01:11:24Z G G false false _310_ 0 2425 303 It's complicated true G false Elisabeth Linton annotation2062219 1 Phasin range2062219 1 1 579 annotation2062218 1 Start range2062218 1 1 3 BBa_K208038_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgaaaaaattattattcgcaattcctttagttgttcctttctattctcactcctactagatgatcctcaccccggaacaagttgcagcagcgcaaaaggccaacctcgaaacgctgttcggcctgaccaccaaggcgtttgaaggcgtcgaaaagctcgtcgagctgaaccttcaggtcgtcaagacttcgttcgcagaaggcgttgacaacgccaagaaggcgctgtcggccaaggacgcacaggaactgctggccatccaggccgcagccgtgcagccggttgccgaaaagaccctggcctacacccgccacctgtatgaaatcgcttcggaaacccagagcgagttcaccaaggtagccgaggctcaactggccgaaggctcgaagaacgtgcaagcgctggtcgagaacctcgccaagaacgccccggccggttcggaatcgaccgtggccatcgtgaagtcggcgatctccgctgccaacaacgcctacgagtcggtgcagaaggcgaccaagcaagcggtcgaaatcgctgaaaccaacttccaggctgcggctacggctgccaccaaggctgcccagcaagccagcgccacggcccgtacggccacggcaaagaagacgacggctgcctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K208002_sequence 1 atgaaaaaattattattcgcaattcctttagttgttcctttctattctcactcc BBa_B0034_sequence 1 aaagaggagaaa BBa_K208001_sequence 1 atgatcctcaccccggaacaagttgcagcagcgcaaaaggccaacctcgaaacgctgttcggcctgaccaccaaggcgtttgaaggcgtcgaaaagctcgtcgagctgaaccttcaggtcgtcaagacttcgttcgcagaaggcgttgacaacgccaagaaggcgctgtcggccaaggacgcacaggaactgctggccatccaggccgcagccgtgcagccggttgccgaaaagaccctggcctacacccgccacctgtatgaaatcgcttcggaaacccagagcgagttcaccaaggtagccgaggctcaactggccgaaggctcgaagaacgtgcaagcgctggtcgagaacctcgccaagaacgccccggccggttcggaatcgaccgtggccatcgtgaagtcggcgatctccgctgccaacaacgcctacgagtcggtgcagaaggcgaccaagcaagcggtcgaaatcgctgaaaccaacttccaggctgcggctacggctgccaccaaggctgcccagcaagccagcgccacggcccgtacggccacggcaaagaagacgacggctgcctga BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z