BBa_K208043 1 BBa_K208043 Lac pL Promoter/RBS/OmpA/PhaP/Terminator 2009-10-19T11:00:00Z 2015-05-08T01:11:25Z Composite Phasin Secretion false false _310_ 0 3473 9 It's complicated false Silver Fusion false USU iGEM 2009 component2056167 1 BBa_K208003 component2056169 1 BBa_B0010 component2056171 1 BBa_B0012 component2056164 1 BBa_B0034 component2056168 1 BBa_K208001 component2056158 1 BBa_R0011 annotation2056158 1 BBa_R0011 range2056158 1 1 54 annotation2056167 1 BBa_K208003 range2056167 1 82 144 annotation2056171 1 BBa_B0012 range2056171 1 826 866 annotation2056169 1 BBa_B0010 range2056169 1 738 817 annotation2056164 1 BBa_B0034 range2056164 1 64 75 annotation2056168 1 BBa_K208001 range2056168 1 151 729 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_K208001 1 BBa_K208001 Phasin (PhaP) 2009-10-07T11:00:00Z 2015-05-08T01:11:24Z G G false false _310_ 0 2425 303 It's complicated true G false Elisabeth Linton annotation2062218 1 Start range2062218 1 1 3 annotation2062219 1 Phasin range2062219 1 1 579 BBa_K208003 1 BBa_K208003 OmpA Signal Peptide - Silver Fusion Compatible 2009-10-11T11:00:00Z 2015-05-08T01:11:24Z Anneal OmpA false false _310_ 0 3473 9 It's complicated false Silver Fusion false USU iGEM 2009 annotation2034605 1 Start Codon range2034605 1 1 3 annotation2034604 1 OmpA range2034604 1 1 63 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K208003_sequence 1 atgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggcc BBa_B0034_sequence 1 aaagaggagaaa BBa_K208001_sequence 1 atgatcctcaccccggaacaagttgcagcagcgcaaaaggccaacctcgaaacgctgttcggcctgaccaccaaggcgtttgaaggcgtcgaaaagctcgtcgagctgaaccttcaggtcgtcaagacttcgttcgcagaaggcgttgacaacgccaagaaggcgctgtcggccaaggacgcacaggaactgctggccatccaggccgcagccgtgcagccggttgccgaaaagaccctggcctacacccgccacctgtatgaaatcgcttcggaaacccagagcgagttcaccaaggtagccgaggctcaactggccgaaggctcgaagaacgtgcaagcgctggtcgagaacctcgccaagaacgccccggccggttcggaatcgaccgtggccatcgtgaagtcggcgatctccgctgccaacaacgcctacgagtcggtgcagaaggcgaccaagcaagcggtcgaaatcgctgaaaccaacttccaggctgcggctacggctgccaccaaggctgcccagcaagccagcgccacggcccgtacggccacggcaaagaagacgacggctgcctga BBa_K208043_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgaaaaagacagctatcgcgattgcagtggcactggctggtttcgctaccgtagcgcaggcctactagatgatcctcaccccggaacaagttgcagcagcgcaaaaggccaacctcgaaacgctgttcggcctgaccaccaaggcgtttgaaggcgtcgaaaagctcgtcgagctgaaccttcaggtcgtcaagacttcgttcgcagaaggcgttgacaacgccaagaaggcgctgtcggccaaggacgcacaggaactgctggccatccaggccgcagccgtgcagccggttgccgaaaagaccctggcctacacccgccacctgtatgaaatcgcttcggaaacccagagcgagttcaccaaggtagccgaggctcaactggccgaaggctcgaagaacgtgcaagcgctggtcgagaacctcgccaagaacgccccggccggttcggaatcgaccgtggccatcgtgaagtcggcgatctccgctgccaacaacgcctacgagtcggtgcagaaggcgaccaagcaagcggtcgaaatcgctgaaaccaacttccaggctgcggctacggctgccaccaaggctgcccagcaagccagcgccacggcccgtacggccacggcaaagaagacgacggctgcctgatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z