BBa_K208100 1 BBa_K208100 Rhodobacter sphaeroides RBS 2009-10-13T11:00:00Z 2015-05-08T01:11:25Z It is from Rhodobacter sphaeroides RBS used for gene expression in photosynthetic bacteria-Rhodobacter sphaeroides. Member of GGAGG6 RBS family. false false _310_ 0 5669 9 Not in stock false GGAGG is the Shine-Dalgarno sequence that has been proved working in Rhodobacter sphaeroides false Junling Huo BBa_K208100_sequence 1 gcaccagggaggtactagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z