BBa_K208103 1 BBa_K208103 Rhodobacter sphaeroides RBS 2009-10-13T11:00:00Z 2015-05-08T01:11:25Z From Rhodobacter sphaeroides. This RBS is designed for gene expression in Rhodobacter sphaeroides. Member of GGAGG8 RBS family. false false _310_ 0 5669 9 Not in stock false Hasn't tested in E coli. false Junling Huo BBa_K208103_sequence 1 tcagtggagggatactagatg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z