BBa_K2082222 1 BBa_K2082222 Mutated fusion protein HA4(Y87A):RpoZ generator 2016-10-07T11:00:00Z 2016-10-21T04:22:04Z Coming soon Coming soon false false _2550_ 30782 30782 9 false Coming soon false Pascal Schmidt component2487633 1 BBa_B1006 component2487621 1 BBa_J23106 component2487628 1 BBa_K2082202 component2487623 1 BBa_B0034 annotation2487628 1 BBa_K2082202 range2487628 1 62 670 annotation2487633 1 BBa_B1006 range2487633 1 679 717 annotation2487621 1 BBa_J23106 range2487621 1 1 35 annotation2487623 1 BBa_B0034 range2487623 1 44 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2082202 1 BBa_K2082202 Mutated fusion protein HA4(Y87A):cMyc:RpoZ 2016-10-06T11:00:00Z 2016-10-20T07:03:08Z Coming Soon Coming Soon false false _2550_ 30782 30782 9 false Coming Soon false Pascal Schmidt annotation2487498 1 cMyc range2487498 1 274 304 annotation2487499 1 monobody HA4 range2487499 1 305 609 annotation2487497 1 rpoZ range2487497 1 1 273 annotation2487500 1 Y87A range2487500 1 562 564 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 annotation1898429 1 modified thr terminator range1898429 1 10 31 BBa_B0034_sequence 1 aaagaggagaaa BBa_K2082202_sequence 1 atggcacgcgtaactgttcaggacgctgtagagaaaattggtaaccgttttgacctggtactggtcgccgcgcgtcgcgctcgtcagatgcaggtaggcggaaaggatccgctggtaccggaagaaaacgataaaaccactgtaatcgcgctgcgcgaaatcgaagaaggtctgatcaacaaccagatcctcgacgttcgcgaacgccaggaacagcaagagcaggaagccgctgaattacaagccgttaccgctattgctgaaggtcgtcgtgaacaaaagcttatttctgaagaggacttgggcagcagcgtgagcagcgtgccgaccaaactggaagtggtggcggcgaccccgaccagcctgctgattagctgggatgcgccgatgagcagcagcagcgtgtattattatcgcattacctatggcgaaaccggcggcaacagcccggtgcaggaatttaccgtgccgtatagcagcagcaccgcgaccattagcggcctgagcccgggcgtggattataccattaccgtgtatgcgtggggcgaagatagcgcgggcgcgatgtttatgtatagcccgattagcattaactatcgcacctgctaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K2082222_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaatactagatggcacgcgtaactgttcaggacgctgtagagaaaattggtaaccgttttgacctggtactggtcgccgcgcgtcgcgctcgtcagatgcaggtaggcggaaaggatccgctggtaccggaagaaaacgataaaaccactgtaatcgcgctgcgcgaaatcgaagaaggtctgatcaacaaccagatcctcgacgttcgcgaacgccaggaacagcaagagcaggaagccgctgaattacaagccgttaccgctattgctgaaggtcgtcgtgaacaaaagcttatttctgaagaggacttgggcagcagcgtgagcagcgtgccgaccaaactggaagtggtggcggcgaccccgaccagcctgctgattagctgggatgcgccgatgagcagcagcagcgtgtattattatcgcattacctatggcgaaaccggcggcaacagcccggtgcaggaatttaccgtgccgtatagcagcagcaccgcgaccattagcggcctgagcccgggcgtggattataccattaccgtgtatgcgtggggcgaagatagcgcgggcgcgatgtttatgtatagcccgattagcattaactatcgcacctgctaatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z