BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2082207 1 BBa_K2082207 Fusion protein SH2:cMyc:cI(434) 2016-10-06T11:00:00Z 2016-10-20T07:18:28Z Coming soon Coming soon false false _2550_ 30782 30782 9 false Coming soon false Pascal Schmidt annotation2487556 1 SH2 domain of Abl1 range2487556 1 316 654 annotation2487554 1 434 cI range2487554 1 1 285 annotation2487555 1 cMyc linker range2487555 1 286 315 BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898431 1 PolyA range1898431 1 1 9 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 BBa_K2082225 1 BBa_K2082225 Fusion protein SH2:cMyc:cI(434) generator 2016-10-07T11:00:00Z 2016-10-21T04:31:34Z Coming soon Coming soon false false _2550_ 30782 30782 9 true Coming soon false Pascal Schmidt component2487659 1 BBa_B1006 component2487648 1 BBa_J23106 component2487650 1 BBa_B0034 component2487654 1 BBa_K2082207 annotation2487650 1 BBa_B0034 range2487650 1 44 55 annotation2487648 1 BBa_J23106 range2487648 1 1 35 annotation2487659 1 BBa_B1006 range2487659 1 724 762 annotation2487654 1 BBa_K2082207 range2487654 1 62 715 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034_sequence 1 aaagaggagaaa BBa_K2082207_sequence 1 atgagtatttcttccagggtaaaaagcaaaaggattcagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagctgaacaaaagcttatttctgaagaggacttgagcctggaaaaacatagctggtatcatggcccggtgagccgcaacgcggcggaatatctgctgagcagcggcattaacggcagctttctggtgcgcgaaagcgaaagcagcccgggccagcgcagcattagcctgcgctatgaaggccgcgtgtatcattatcgcattaacaccgcgagcgatggcaaactgtatgtgagcagcgaaagccgctttaacaccctggcggaactggtgcatcatcatagcaccgtggcggatggcctgattaccaccctgcattatccggcgccgaaacgcaacaaaccgaccgtgtatggcgtgagcccgaactattaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K2082225_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaatactagatgagtatttcttccagggtaaaaagcaaaaggattcagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagctgaacaaaagcttatttctgaagaggacttgagcctggaaaaacatagctggtatcatggcccggtgagccgcaacgcggcggaatatctgctgagcagcggcattaacggcagctttctggtgcgcgaaagcgaaagcagcccgggccagcgcagcattagcctgcgctatgaaggccgcgtgtatcattatcgcattaacaccgcgagcgatggcaaactgtatgtgagcagcgaaagccgctttaacaccctggcggaactggtgcatcatcatagcaccgtggcggatggcctgattaccaccctgcattatccggcgccgaaacgcaacaaaccgaccgtgtatggcgtgagcccgaactattaatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z