BBa_K2082208 1 BBa_K2082208 Fusion protein Gal4:RpoZ 2016-10-06T11:00:00Z 2016-10-20T07:36:43Z Coming soon Coming soon false false _2550_ 30782 30782 9 false Coming soon false Pascal Schmidt annotation2525693 1 RpoZ range2525693 1 1 273 annotation2526025 1 Gal4 range2526025 1 283 426 annotation2526024 1 AAA-linker range2526024 1 274 282 BBa_K2082226 1 BBa_K2082226 Fusion protein Gal4:RpoZ generator 2016-10-07T11:00:00Z 2016-10-21T04:35:02Z Coming soon Coming soon false false _2550_ 30782 30782 9 false Coming soon false Pascal Schmidt component2487672 1 BBa_J23106 component2487675 1 BBa_K2082208 component2487674 1 BBa_B0034 component2487680 1 BBa_B1006 annotation2487672 1 BBa_J23106 range2487672 1 1 35 annotation2487674 1 BBa_B0034 range2487674 1 44 55 annotation2487680 1 BBa_B1006 range2487680 1 496 534 annotation2487675 1 BBa_K2082208 range2487675 1 62 487 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B1006 1 BBa_B1006 Terminator (artificial, large, %T~>90) 2006-08-30T11:00:00Z 2015-08-31T04:07:21Z modified E. coli thr terminator, replaced all A-T pairs in stem with C-G pairs Released HQ 2013 Artificial terminator, estimated %T~>90% *8bp stem, 6nt loop *Bidirectional, estimated reverse %T~>90% false true _41_ 0 745 41 In stock false Bidirectional, with the reverse estimated to be less effective than the forward. Has a polyA tail of 9 residues. true Haiyao Huang annotation1898431 1 PolyA range1898431 1 1 9 annotation1898429 1 modified thr terminator range1898429 1 10 31 annotation1898430 1 PolyA range1898430 1 32 39 annotation1898428 1 B1006 range1898428 1 1 39 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_B0034_sequence 1 aaagaggagaaa BBa_K2082208_sequence 1 atggcacgcgtaactgttcaggacgctgtagagaaaattggtaaccgttttgacctggtactggtcgccgcgcgtcgcgctcgtcagatgcaggtaggcggaaaggatccgctggtaccggaagaaaacgataaaaccactgtaatcgcgctgcgcgaaatcgaagaaggtctgatcaacaaccagatcctcgacgttcgcgaacgccaggaacagcaagagcaggaagccgctgaattacaagccgttaccgctattgctgaaggtcgtcgtgcggcggcgcgcgcgcatctgaccgaagtggaaagccgcctggaacgcctggaacagctgtttctgctgatttttccgcgcgaagatctggatatgattctgaaaatggatagcctacaggatattaaagcgctgctgaccggcctgttttaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_B1006_sequence 1 aaaaaaaaaccccgcccctgacagggcggggtttttttt BBa_K2082226_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaatactagatggcacgcgtaactgttcaggacgctgtagagaaaattggtaaccgttttgacctggtactggtcgccgcgcgtcgcgctcgtcagatgcaggtaggcggaaaggatccgctggtaccggaagaaaacgataaaaccactgtaatcgcgctgcgcgaaatcgaagaaggtctgatcaacaaccagatcctcgacgttcgcgaacgccaggaacagcaagagcaggaagccgctgaattacaagccgttaccgctattgctgaaggtcgtcgtgcggcggcgcgcgcgcatctgaccgaagtggaaagccgcctggaacgcctggaacagctgtttctgctgatttttccgcgcgaagatctggatatgattctgaaaatggatagcctacaggatattaaagcgctgctgaccggcctgttttaatactagagaaaaaaaaaccccgcccctgacagggcggggtttttttt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z