BBa_K2083013 1 BBa_K2083013 Beta globin Guide RNA 2016-10-13T11:00:00Z 2016-10-14T04:11:06Z This is complimentary to an mRNA sequence from human beta globin. Oligonucleotide sequence used to guide dCas9 to GFP reporter fused to human beta globin coding region. A wild type globin GFP reporter can be found here part BBa_K2083012, and one with a premature stop codon (PTC) at BBa_K2083011. false false _2551_ 31287 31287 9 false Complimentary to sequence of human beta globin. false Virginia Massa BBa_K2083013_sequence 1 aaaggtgcctttgaggttgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z