BBa_K2083014 1 BBa_K2083014 Mutated Start Codon Guide RNA 2016-10-13T11:00:00Z 2016-10-14T04:13:18Z Complimentary to a sequence of GAPDH gene used a 5' UTR for a GFP sequence. Oligonucleotide sequence used to guide dCas9 to GFP reporter. A wild type GFP reporter can be found here part BBa_K2083009, and one with a mutated (ACG) start codon BBa_K2083010. false false _2551_ 31287 31287 9 false Complimentary to a sequence of GAPDH gene false Virginia Massa BBa_K2083014_sequence 1 ggggcagagatgatgaccct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z