BBa_K2084000 1 BBa_K2084000 T3 Promoter 2016-10-11T11:00:00Z 2016-10-29T09:13:21Z Wild-type found in T3 bacteriophage. Synthesized by IDT. Promoter for the T3 RNA Polymerase. false false _2552_ 32066 32131 9 false NA false Maya Lemmon-Kishi BBa_K2084000_sequence 1 aattaaccctcactaaagggaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z