BBa_K2084002 1 BBa_K2084002 pT7 Toehold 2016-10-11T11:00:00Z 2016-10-29T09:24:28Z Synthetic, developed by the Collins Lab at MIT. Toehold switch with T7 RNAP promoter. false false _2552_ 32066 32131 9 false Determining the sequence to be the trigger to activate and open up the toehold structure. false Aife Ni Chochlain BBa_K2084002_sequence 1 taatacgactcactatagggagagggatctattactacttaccattgtcttgctctatacagaaacagaggagatatagaatgagacaatggaacctggcggcagcgcaaaagatgcgtaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z