BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2084004 1 BBa_K2084004 T3 Promoter with RBS site 2016-10-13T11:00:00Z 2016-10-29T09:48:58Z The T3 promoter comes from the T3 bacteriophage. The RBS site comes from... This is the T3 promoter with an RBS site added. Other groups should use this part to regulate their part by adding it in front. false false _2552_ 32066 32131 9 false NA false Maya Lemmon-Kishi component2531295 1 BBa_K2084000 component2531297 1 BBa_B0034 annotation2531297 1 BBa_B0034 range2531297 1 32 43 annotation2531295 1 BBa_K2084000 range2531295 1 1 23 BBa_K2084000 1 BBa_K2084000 T3 Promoter 2016-10-11T11:00:00Z 2016-10-29T09:13:21Z Wild-type found in T3 bacteriophage. Synthesized by IDT. Promoter for the T3 RNA Polymerase. false false _2552_ 32066 32131 9 false NA false Maya Lemmon-Kishi BBa_K2084000_sequence 1 aattaaccctcactaaagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_K2084004_sequence 1 aattaaccctcactaaagggagatactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z