BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_E0040 1 GFP green fluorescent protein derived from jellyfish Aequeora victoria wild-type GFP (SwissProt: P42212 2004-09-29T11:00:00Z 2016-01-26T02:09:38Z Released HQ 2013 GFP (mut3b) [note that this part does not have a barcode] false true _11_1_ 4206 61 7 In stock false true jcbraff annotation1934520 1 GFP protein range1934520 1 1 720 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 BBa_K2084004 1 BBa_K2084004 T3 Promoter with RBS site 2016-10-13T11:00:00Z 2016-10-29T09:48:58Z The T3 promoter comes from the T3 bacteriophage. The RBS site comes from... This is the T3 promoter with an RBS site added. Other groups should use this part to regulate their part by adding it in front. false false _2552_ 32066 32131 9 false NA false Maya Lemmon-Kishi component2531295 1 BBa_K2084000 component2531297 1 BBa_B0034 annotation2531297 1 BBa_B0034 range2531297 1 32 43 annotation2531295 1 BBa_K2084000 range2531295 1 1 23 BBa_K2084000 1 BBa_K2084000 T3 Promoter 2016-10-11T11:00:00Z 2016-10-29T09:13:21Z Wild-type found in T3 bacteriophage. Synthesized by IDT. Promoter for the T3 RNA Polymerase. false false _2552_ 32066 32131 9 false NA false Maya Lemmon-Kishi BBa_K2084006 1 BBa_K2084006 pT3 Controlled GFP 2016-10-15T11:00:00Z 2016-10-16T02:47:06Z T3 RNAP promoter is from T3 Bacteriophage GFP is from... We obtained the whole sequence from AddGene and Christopher Voigt. This composite part contains the T3 RNAP promoter site to translate GFP. This can be used as a reporter. false false _2552_ 32131 32131 9 false We had to create primers to PCR amplify the sequence out so that it was in the BioBrick compatible backbone. false Maya Lemmon-Kishi component2513406 1 BBa_K2084004 component2513408 1 BBa_E0040 component2513404 1 BBa_B0032 annotation2513404 1 BBa_B0032 range2513404 1 32 44 annotation2513406 1 BBa_K2084004 range2513406 1 1 44 annotation2513408 1 BBa_E0040 range2513408 1 51 770 BBa_K2084000_sequence 1 aattaaccctcactaaagggaga BBa_B0034_sequence 1 aaagaggagaaa BBa_B0032_sequence 1 tcacacaggaaag BBa_K2084004_sequence 1 aattaaccctcactaaagggagatactagagaaagaggagaaa BBa_K2084006_sequence 1 aattaaccctcactaaagggagatactagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa BBa_E0040_sequence 1 atgcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z