BBa_K2087002 1 BBa_K2087002 CRISPR/Cas9 sgRNA Targeting Locus 401 on the DD96 Human Gene 2016-10-18T11:00:00Z 2016-10-19T06:28:26Z The T7 cassette comes from the BBa_K1818000 biobrick. The sequence for the spacer is complementary to the human DD96 gene. This is the transcript for the sgRNA that hybridizes with S. pyogenes Cas9 in order to guide the endonuclease to make a double stranded break at a sequence complementary to the RNA. The transcription is under a the control of a T7 promoter, and targets the 401 locus on the human DD96 gene. This particular sgRNA is created from the BBa_K1818000 biobrick, which is an empty sgRNA cassette with two adjacent Bbs1 cut sites where the target spacer should go. This part was created by digesting the empty cassette with Bbs1 and ligating the 20bp spacer to reform the plasmid. false false _2555_ 20226 20226 9 false No design considerations. false Nikhil Nair annotation2523137 1 BBa_K1818000 range2523137 1 1 121 annotation2523491 1 T7 Promoter range2523491 1 1 15 annotation2523684 1 sgRNA range2523684 1 33 121 annotation2523591 1 Target 401 Spacer range2523591 1 16 32 BBa_K2087002_sequence 1 tagagtaatacgactcactatagggcatgggctgtgaaagctgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgcttttttatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z