BBa_K2088001 1 BBa_K2088001 copA promoter 2016-09-22T11:00:00Z 2016-09-23T08:37:16Z genomic DNA CopA, the principal copper efflux ATPase in Escherichia coli, is induced by elevated copper in the medium.The copA promoter is Copper-responsive and regulated by CueR,a Member of the MerR Family. false false _2556_ 33447 33447 9 false no false chenrui qin BBa_K2088001_sequence 1 cctttttatagatgcgggaggtaattcctcaccccggtgccgattttcaggcatcctgatttaacttagcacccgcaacttaactacaggaaaacaaagagataaatgtctaatcctgatgcaaatcgagccgattttttaatctttacggacttttacccgcctggtttattaatttcttgaccttccccttgctggaaggtttaacctttatcacagccagtcaaaactgtcttaaaggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z