BBa_K2088007 1 BBa_K2088007 pbaB: a 2Fe-2S ferredoxin, a 2Fe-2S iron-sulfur cluster binding domain. 2016-10-07T11:00:00Z 2016-10-14T05:51:25Z The number in genebank is KJ009324.1【link https://www.ncbi.nlm.nih.gov/protein/633267949】 And it comes from Sphingobium wenxiniae JZ-1. reference: A Novel Angular Dioxygenase Gene Cluster Encoding 3-Phenoxybenzoate 1=,2=-Dioxygenase in Sphingobium wenxiniae JZ-1, Chenghong Wang, Qing Chen, Rui Wang, Chao Shi, Xin Yan, Jian He, Qing Hong, Shunpeng Li Key Laboratory of Agricultural Environmental Microbiology, Ministry of Agriculture, College of Life Sciences, Nanjing Agricultural University, Nanjing, China. PbaB is a [2Fe-2S]-type ferredoxin, located in Sphingobium wenxiniae JZ-1.It can express in Ecoli（DH）5ɑ or BL21 in plasmid pPBA. It encodes a kind of protein named 2Fe-2S ferredoxin, a 2Fe-2S iron-sulfur cluster binding domain. Iron-sulfur proteins play an important role in electron transfer processes and in various enzymatic reactions. Mostly, pbaB Implement function with pbaA1A2. PbaA1A2B are the oxygenase and ferredoxin components of the angular dioxygenase (3-phenoxybenzoate 1???,2???-dioxygenase) responsible for the angular dioxygenation at the 1??? and 2??? positions on the benzene moiety of 3-phenoxybenzoate and that the ferredoxin PbaB is indispensable for the angular dioxygenase false false _2556_ 33751 33723 9 false We have searched the function of pbaB ,and the relationship between pbaA1A2. false Yuxin He annotation2501942 1 ATG start codon range2501942 1 1 3 annotation2501943 1 TAG stop codon range2501943 1 319 321 BBa_K2088007_sequence 1 atggttacaatcacatatatcacgtcggacggacgtgaatttacggtcaatgccgagatcggcgatacggtaatgcgcgcggcccaagcgcatggtgttccggggatcgaggccgagtgcgggggcggcctcacctgcgcgacgtgccgggtgggcattcccccggaatggcaggggcgcctttctccagccagcgcggacgaacagaccatgctggaatattgcgaggatccggccccagccactcgcctcagttgccagatcgagatcgaccagtcgctggatggcctgcgcgtcaccatccctgagacgcaacactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z