BBa_K2088013 1 BBa_K2088013 Mhbpt: a promoter that can be induced by 3-HBA and MhbR. 2016-10-07T11:00:00Z 2016-10-14T01:15:18Z The gene can be gotton from the bacteria M5a1, and the sequence comes from GenBank https://www.ncbi.nlm.nih.gov/nuccore/EU165545.1 Mhbpt is a promoter that can be induced by the compound of MhbR and the 3-HBA. The promoter contains the binding site to bind the complex. It is a bidirectional promoter for the two promoters have a partial overlap. false false _2556_ 33751 29893 9 false None false Shi Kejian annotation2488228 1 complex binding site range2488228 1 343 435 annotation2488225 1 Mhbpt left promoter range2488225 1 303 329 annotation2488227 1 complex binding site range2488227 1 1 302 annotation2488226 1 Mhbpt right promoter range2488226 1 323 342 BBa_K2088013_sequence 1 gctcgatctcatactgcgaacgcgacatatcgttaatcagccgctgggcgtgctgaagcagcagcttcccgccttcggtcgggcgcaggcctttgctatggcgttcgaacaaaaccatgccgacttcgtcttcaaactggctgagccatttggagagcgcgggctgagtaatgttcatcattttcgccacctgcgtgagattgccttgctcccccagcgccaccagcatctgtaaatggtgcagcttcactttctgcgtccagtccgccattagcgataacctccaggttatgtctatgcccgaaataccattgtacatttcattgcctgagttacaaactcgcaacataaaagaaataaatacaacacctacccctacctgcactgaggcataacgatgactcaacgacttgaattacagaagctgctcaacgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z