BBa_K2090000 1 BBa_K2090000 phoA->LbCHI31->Flag tag 2016-10-13T11:00:00Z 2016-10-14T09:55:32Z Alkaline phosphatase, or phoA, is a periplasmic protein in Escherichia coli that can be used by membrane vesicles in vitro for protein transportation. LbCHI31 originates from the Limonium bicolor genome; the coding sequence was taken from GenBank: ABD92819.1. This linked protein encodes a Limonium bicolor-derived LbCHI31 chitinase enzyme with the signal sequence of phoA (alkaline phosphatase) linked upstream of the chitinase gene by a glycine-serine linker. Downstream from the LbCHI31 gene is a FLAG tag used for protein expression and production analysis via immunoprecipitation. The translated protein encodes a chitinolytic enzyme that can be secreted extracellularly by Escherichia coli; the presence of this protein can be identified using anti-FLAG antibodies. false false _2558_ 27338 27338 9 false Signal sequence peptides allow for secretion of linked proteins located downstream of the signal sequence; as such, the phoA signal had to be designed upstream of the LbCHI31. The FLAG tag must flank the 3' end of the genetic sequence for proper location on the translated protein for immunoprecipitation. The stop codons on phoA and LbCHI31 were eliminated, and a stop codon was added downstream of the FLAG tag. Similarly, ATG methionine was eliminated from LbCHI31 and only retained in phoA to initiate translation at the phoA site. false Anthony Kang annotation2511865 1 start range2511865 1 1 3 annotation2511866 1 phoA range2511866 1 1 63 annotation2511903 1 Stop codon range2511903 1 1075 1077 annotation2511868 1 LbCHI31 range2511868 1 78 1035 annotation2511902 1 FLAG range2511902 1 1053 1074 BBa_K2090000_sequence 1 atgaaacaatcgacgatcgcattggctttacttcctctgctgttcacacctgttacgaaggcaggctcgggctccggtagcaaaacgactttaatcttaactgctgccgcgttgcctttcttattactgatctccttctcttccgcagagcagtgcggctctcaggcaggcggagcggtgtgtcctaacggcctgtgctgtagtaaatatggatggtgcggatcaaccgatacgtattgtaaggatggatgtcaatcccaatgtggtggcaccactcctacccccaccacccccacacccacccctactcaggggggtgatgtctcaagcatcatctcgcagagtaatttcgatgagatgttaaaacatcgtaacgacaacgcttgttcaggccatggtttttacacgtatgccgcttttatcagcgccgcccaatcatttccgggatttggtacaacgggagataccgatactcgcaaacgcgaacttgcggcgttcttagggcagacgtcacatgaaaccactggtggatgggccgcagcccctgatggaccgtatgcttggggctactgtttcgtgcaagaacagggcgcctcaggcgcgttctgtacgtctcccgaatatccgtgtgccccaggtaagcaatactatggccgtgggccaattcaattgacgcacaactacaattacgcgcaggcgggtacggctatcaatcaggatcttatcaataaccctgatttagttgccactgaccccacgatctcattcaagacagctatctggttctggatgacaccccaatccaacaagccgtcgtcgcacgacgtaatcactggtaaatggaccccgtcgtctgcggatagtgcggctgggcgtgtgccgggatatggtgttattacgaatatcattaatggtggacttgaatgtggtaaaggtagtatcgcaaaacaagaggaccgtatcggcttctataagcgctattgcgatgtattaggcgtgggctatgggaataatcttgattgcaattcccaacgtccatttgcgggtagcgattacaaggacgatgacgacaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z