BBa_K2090001 1 BBa_K2090001 phoA->LbCHI32->Flag tag 2016-10-13T11:00:00Z 2016-10-14T09:44:18Z Alkaline phosphatase, or phoA, is a periplasmic protein in Escherichia coli that can be used by membrane vesicles in vitro for protein transportation. LbCHI31 originates from the Limonium bicolor genome; the coding sequence was taken from GenBank: ACE79211.1. This linked protein encodes a Limonium bicolor-derived LbCHI32 chitinase enzyme with the signal sequence of phoA (alkaline phosphatase) linked upstream of the chitinase gene by a glycine-serine linker. Downstream from the LbCHI31 gene is a FLAG tag used for protein expression and production analysis via immunoprecipitation. The translated protein encodes a chitinolytic enzyme that can be secreted extracellularly by Escherichia coli; the presence of this protein can be identified using anti-FLAG antibodies. false false _2558_ 27338 27338 9 false Signal sequence peptides allow for secretion of linked proteins located downstream of the signal sequence; as such, the phoA signal had to be designed upstream of the LbCHI32. The FLAG tag must flank the 3' end of the genetic sequence for proper location on the translated protein for immunoprecipitation. The stop codons on phoA and LbCHI32 were eliminated, and a stop codon was added downstream of the FLAG tag. Similarly, ATG methionine was eliminated from LbCHI32 and only retained in phoA to initiate translation at the phoA site. false TP_CC-SanDiego 2016 annotation2511917 1 start range2511917 1 1 3 annotation2511916 1 phoA range2511916 1 1 63 annotation2511920 1 FLAG range2511920 1 1041 1065 annotation2511919 1 stop range2511919 1 1066 1068 annotation2511918 1 LbCHI32 range2511918 1 78 1035 BBa_K2090001_sequence 1 atgaaacagtctaccattgctctggcactgttaccccttttatttactccggttacgaaggccggtagtggctcgggatcgggtcgccactggcgcttagtcattgtagcaattgtgactaccgctctgctgggagccaatctttccgcggcactggaccttacggatcagcttgttactaaggaggtcaagggcaaaaaagtttgcaagatgggctgggcatgtcctgaattttctaagttctgctgcaaccagacaattccagaatttttagacgtcgaccaattccagcagctgtttcccaacatcaacgccccaaccgcccatgctgtaggcttttgggactaccagagtttcgttcttgctaccatcaaatatgccccacttggctttggtacgacgggcggtaaacttatgggacaacttgaattagccgcctttttagggcatgttggatcgcaaacgtcctgcggctatggtgtggcaactggcggaccaactgcttggggtttatgctacaacaaggagttgagtccttcccaaaaatactgtgacgacagctacaagtatacatatccatgcacgccgggtgcggactactacggtcgcggtgctcttcccatttattggaactacaattatggacagatcggggatgcgttgcaggaaaacttactggaccatcccgaatacatcgagcagaacgccaccttagcattccaagctgccatttactcgtggatgacacctaaaaaaaaggggcagccttcgtgtcacgacgcgtttgtggggaattggaaaccaaacaaaaacgatacgttatcgaagcgtgtcccaggtttcggagtcacgatgaacatcctttacggggatcgcacttgtgggcagggagacgttgacgatatgaacacgattattacccattacctttattacctggacgagatgggagtaggacgtgagcgcgcaggccctgctgaggtcttatcctgtgccgaacaaaaaccttttaacccgtccgggtcagccagctcaggtagcgactataaagacgacgacgacaaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z