BBa_K2092002 1 BBa_K2092002 PalcA, improved alcR inducible promoter from A. nidulans 2016-09-30T11:00:00Z 2016-10-02T01:52:41Z Aspergillus nidulans, sequence found through The alcA promoter is one of the strongest inducible promoters in Aspergillus nidulans. Its transciptional activation is dependent on the binding of its positive transcriptional regulator AlcR with various substrates that employ a hydroxyl group, for example ethanol and threonine. The native AlcA promoter consists of 3 AlcR binding sites. The number and position of the AlcR binding sites on the alcA promoter are crucial in determining its transcriptional activation strength. It has also been shown that each AlcR target in the alcA promoter contributes differently to the activation of the downstream protein expression. This part is an improved BioBrick previously characterised by 2011 iGEM DTU-Denmark. Sequencing results showed that two Prefix/Suffix restriction sites XbaI and SpeI were absent in the original part. Hence the two missing restriction sites were added using PCR. false false _2560_ 31195 31195 9 false To add the missing XbaI and SpeI restriction sites, the following two primers were designed: alcA forward primer = 5'- CGG AAT TCG CGT CTA GAA CGT CGC TCT CCC CGA TGA C -3' alcA reverse primer = 5'- AAC TGC AGA AAC CAA TGC ATT GGA CTA GTT TTT GAG GCG AGG TGA TAG GAT TGG -3' false Hui Wen Chong annotation2485608 1 PalcA range2485608 1 1 843 BBa_K2092002_sequence 1 acgtcgctctccccgatgacatacaggaggggtcagggcattcgagaaataccgtggatacagttgggcatttctagggctgaatgggaaggagagagttttgaaataggcgttccgttctgcttagggtatttgggaacaatcaatgttcaatgtacatttaatccacgattttataaaacgtcatcctttgccctcccttcttatttgccaataccaaaaatcttactccagtggttcggtaatcgcagagttaaatctgggctcggtggcagatctgcgatgctccataaccgttcagatgttgattggaactgggtggggtagacagctcgaagaccgagtgaacgtatacctaagacactttgacacggccggaacactgtaagtcccttcgtatttctccgcctgtgtggagctaccatccaataacccccagctgaaaagctgattgtgatagttcccacttgtccgtccgcatcggcatccgcagctcgggatagttccgacctaggattggatgcatgcggaaccgcacgagggcggggcggaaattgacacaccactcctctccacgcaccgttcaagaggtacgcgtatagagccgtatagagcagagacggagcactttctggtactgtccgcacgggatgtccgcacggagagccacaaacgagcggggccccgtacgtgctctcctaccccaggatcgcatccccgcatagctgaacatctatataaagacccccaaggttctcagtctcaccaacatcatcaaccaacaatcaacagttctctactcagttaattagaactcttccaatcctatcacctcgcctcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z