BBa_K2092003 1 BBa_K2092003 PalcA(var), alcR inducible promoter variant from A. nidulans 2016-09-30T11:00:00Z 2016-10-09T04:57:24Z Aspergillus nidulans, sequence found through P<i>alcA</i> is one of the strongest inducible promoters in <i>Aspergillus nidulans</i> commonly used to overexpress proteins [1]. It has been shown that P<i>alcA</i> promoter is also functional in monocotyledonous plant sugar cane [2] and <i>Escherichia coli (E.coli)</i>[3]. Its transcriptional activation is dependent on the binding of its positive transcriptional regulator AlcR with various substrates that employ a hydroxyl group, for example ethanol and threonine. The native P<i>alcA</i> consists of 3 AlcR binding sites. The number and position of the AlcR binding sites on the P<i>alcA</i> are crucial in determining its transcriptional activation strength. It has also been shown that each AlcR target in the P<i>alcA</i> contributes differently to the activation of the downstream protein expression [1]. This part is a variant of P<i>alcA</i> <a href=http://parts.igem.org/Part:BBa_K2092002>(BBa_K2092002)</a>. In contrast to the native construct (three AlcR binding sites <i>abc</i>), this variant consists only two binding sites <i>bc</i>. Previous study on sugarcane has shown that there is a 70% decrease in promoter strength for P<i>alcA</i> with only binding sites <i>bc</i> [2]. This finding, however, has not been verified using <i>E.coli</i> as a chassis. This then forms the very basis of our project. References: [1] Panozzo, C., Capuano, V., Fillinger, S. and Felenbok, B. (1997). The zinc binuclear cluster Activator AlcR is able to bind to single sites but requires multiple repeated sites for synergistic activation of the alcA gene in <i>Aspergillus nidulans</i>. <i>Journal of Biological Chemistry</i>, 272(36), 22859???22865. [2] Kinkema, M., Geijskes, R.J., Shand, K., Coleman, H.D., De Lucca, P.C., Palupe, A., Harrison, M.D., Jepson, I., Dale, J.L. and Sainz, M.B. (2013). An improved chemically inducible gene switch that functions in the monocotyledonous plant sugar cane. <i>Plant Molecular Biology</i>, 84(4-5), 443???454. [3] Hemmati, H. and Basu, C. (2015). Transcriptional analyses of an ethanol inducible promoter in <i>Escherichia coli</i> and tobacco for production of cellulase and green fluorescent protein. <i>Biotechnology & Biotechnological Equipment</i>, 29(6), 1043???1052. false false _2560_ 31195 31195 9 false - false Hui Wen Chong annotation2485609 1 PalcAv range2485609 1 1 762 BBa_K2092003_sequence 1 acgtcgctctccccgatgacatacaggaggggtcagggcattcgagaaataccgtggatacagttgggcatttctagggctgaatgggaaggagagagttttgaaataggcgttccgttctgcttagggtatttgggaacaatcaatgttcaatgtacatttaatccacgattttataaaacgtcatcctttgccctcccttcttatttgccaataccaaaaatcttactccagtggttcggtaatcgcagagttaaatctgggctcggtggcagatctgcgatgctccataaccgttcagatgttgattggaactgggtggggtagacagctcgaagaccgagtgaacgtatacctaagacactttgacacggccggaacactgtaagtcccttcgtatttctccgcctgtgtggagctaccatccaataacccccagatgcatgcggaaccgcacgagggcggggcggaaattgacacaccactcctctccacgcaccgttcaagaggtacgcgtatagagccgtatagagcagagacggagcactttctggtactgtccgcacgggatgtccgcacggagagccacaaacgagcggggccccgtacgtgctctcctaccccaggatcgcatccccgcatagctgaacatctatataaagacccccaaggttctcagtctcaccaacatcatcaaccaacaatcaacagttctctactcagttaattagaactcttccaatcctatcacctcgcctcaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z