BBa_K2092003 1 BBa_K2092003 PalcA(var), alcR inducible promoter variant from A. nidulans 2016-09-30T11:00:00Z 2016-10-09T04:57:24Z Aspergillus nidulans, sequence found through P<i>alcA</i> is one of the strongest inducible promoters in <i>Aspergillus nidulans</i> commonly used to overexpress proteins [1]. It has been shown that P<i>alcA</i> promoter is also functional in monocotyledonous plant sugar cane [2] and <i>Escherichia coli (E.coli)</i>[3]. Its transcriptional activation is dependent on the binding of its positive transcriptional regulator AlcR with various substrates that employ a hydroxyl group, for example ethanol and threonine. The native P<i>alcA</i> consists of 3 AlcR binding sites. The number and position of the AlcR binding sites on the P<i>alcA</i> are crucial in determining its transcriptional activation strength. It has also been shown that each AlcR target in the P<i>alcA</i> contributes differently to the activation of the downstream protein expression [1]. This part is a variant of P<i>alcA</i> <a href=http://parts.igem.org/Part:BBa_K2092002>(BBa_K2092002)</a>. In contrast to the native construct (three AlcR binding sites <i>abc</i>), this variant consists only two binding sites <i>bc</i>. Previous study on sugarcane has shown that there is a 70% decrease in promoter strength for P<i>alcA</i> with only binding sites <i>bc</i> [2]. This finding, however, has not been verified using <i>E.coli</i> as a chassis. This then forms the very basis of our project. References: [1] Panozzo, C., Capuano, V., Fillinger, S. and Felenbok, B. (1997). The zinc binuclear cluster Activator AlcR is able to bind to single sites but requires multiple repeated sites for synergistic activation of the alcA gene in <i>Aspergillus nidulans</i>. <i>Journal of Biological Chemistry</i>, 272(36), 22859???22865. [2] Kinkema, M., Geijskes, R.J., Shand, K., Coleman, H.D., De Lucca, P.C., Palupe, A., Harrison, M.D., Jepson, I., Dale, J.L. and Sainz, M.B. (2013). An improved chemically inducible gene switch that functions in the monocotyledonous plant sugar cane. <i>Plant Molecular Biology</i>, 84(4-5), 443???454. [3] Hemmati, H. and Basu, C. (2015). Transcriptional analyses of an ethanol inducible promoter in <i>Escherichia coli</i> and tobacco for production of cellulase and green fluorescent protein. <i>Biotechnology & Biotechnological Equipment</i>, 29(6), 1043???1052. false false _2560_ 31195 31195 9 false - false Hui Wen Chong annotation2485609 1 PalcAv range2485609 1 1 762 BBa_K1033930 1 BBa_K1033930 amilCP, blue/purple chromoprotein (incl RBS) 2013-09-16T11:00:00Z 2015-05-08T01:08:50Z Acropora millepora This chromoprotein from the coral Acropora millepora, amilCP, naturally exhibits strong color when expressed. The protein has an absorbance maximum at 588 nm giving it a blue/purple color visible to the naked eye, thereby requiring no instruments to observe. The strong color is readily observed in both LB or agar culture, in less than 24 hours of incubation. false false _1340_ 0 13997 9 In stock false Illegal internal restriction site had to be removed (EcoRI). false Erik Lundin component2351894 1 BBa_K592009 component2351892 1 BBa_B0034 annotation2351892 1 BBa_B0034 range2351892 1 1 12 annotation2351894 1 BBa_K592009 range2351894 1 19 687 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K592009 1 amilCP amilCP, blue chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:48Z Acropora millepora Released HQ 2013 This chromoprotein, amilCP, naturally exhibits very strong color when expressed. The color is blue/purple and is visible to naked eye, thereby requiring no instruments to observe. This DNA was provided by Jeffrey Miller at UCLA. It was made BioBrick-compatible after removal of one illegal internal restriction site (EcoRI). false false _763_ 0 7929 9 In stock true Illegal internal restriction site had to be removed (EcoRI). false Lei Sun annotation2131628 1 amilCP range2131628 1 1 666 BBa_K2092009 1 BBa_K2092009 PalcA(var) + RBS (B0034) +amilCP 2016-10-01T11:00:00Z 2016-10-09T05:07:40Z <i>Aspergillus nidulans</i>. The promoter was first characterized by ?, codon optimized for E.coli by Thermo Fischer Scientific and synthesized by IDT. The construct was assembled using the 3A BioBrick Assembly Method as recommended by iGEM. PalcA is one of the strongest inducible promoters in Aspergillus nidulans commonly used to overexpress proteins [1]. It has been shown that PalcA promoter is also functional in monocotyledonous plant sugar cane [2] and Escherichia coli (E.coli) [3]. Its transcriptional activation is dependent on the binding of its positive transcriptional regulator AlcR with various substrates that employ a hydroxyl group, for example ethanol and threonine. The native PalcA consists of 3 AlcR binding sites. The number and position of the AlcR binding sites on the PalcA are crucial in determining its transcriptional activation strength. It has also been shown that each AlcR target in the PalcA contributes differently to the activation of the downstream protein expression [1]. In contrast to the native construct (three AlcR binding sites abc), this variant consists only two binding sites bc. Previous study on sugarcane has shown that there is a 70% decrease in promoter strength for PalcA with only binding sites bc [2]. This part allows detection of ethanol by coupling it with another composite part, <a href="http://parts.igem.org/Part:BBa_K2092008"> BBa_K2092008</a>, which constitutively expresses its transcription factor, AlcR. Blue color development can be seen in presence of ethanol. false false _2560_ 31195 31195 9 false - false Hui Wen Chong component2485641 1 BBa_K2092003 component2485646 1 BBa_K1033930 annotation2485646 1 BBa_K1033930 range2485646 1 771 1457 annotation2485641 1 BBa_K2092003 range2485641 1 1 762 BBa_K1033930_sequence 1 aaagaggagaaatactagatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_B0034_sequence 1 aaagaggagaaa BBa_K2092003_sequence 1 acgtcgctctccccgatgacatacaggaggggtcagggcattcgagaaataccgtggatacagttgggcatttctagggctgaatgggaaggagagagttttgaaataggcgttccgttctgcttagggtatttgggaacaatcaatgttcaatgtacatttaatccacgattttataaaacgtcatcctttgccctcccttcttatttgccaataccaaaaatcttactccagtggttcggtaatcgcagagttaaatctgggctcggtggcagatctgcgatgctccataaccgttcagatgttgattggaactgggtggggtagacagctcgaagaccgagtgaacgtatacctaagacactttgacacggccggaacactgtaagtcccttcgtatttctccgcctgtgtggagctaccatccaataacccccagatgcatgcggaaccgcacgagggcggggcggaaattgacacaccactcctctccacgcaccgttcaagaggtacgcgtatagagccgtatagagcagagacggagcactttctggtactgtccgcacgggatgtccgcacggagagccacaaacgagcggggccccgtacgtgctctcctaccccaggatcgcatccccgcatagctgaacatctatataaagacccccaaggttctcagtctcaccaacatcatcaaccaacaatcaacagttctctactcagttaattagaactcttccaatcctatcacctcgcctcaaa BBa_K592009_sequence 1 atgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa BBa_K2092009_sequence 1 acgtcgctctccccgatgacatacaggaggggtcagggcattcgagaaataccgtggatacagttgggcatttctagggctgaatgggaaggagagagttttgaaataggcgttccgttctgcttagggtatttgggaacaatcaatgttcaatgtacatttaatccacgattttataaaacgtcatcctttgccctcccttcttatttgccaataccaaaaatcttactccagtggttcggtaatcgcagagttaaatctgggctcggtggcagatctgcgatgctccataaccgttcagatgttgattggaactgggtggggtagacagctcgaagaccgagtgaacgtatacctaagacactttgacacggccggaacactgtaagtcccttcgtatttctccgcctgtgtggagctaccatccaataacccccagatgcatgcggaaccgcacgagggcggggcggaaattgacacaccactcctctccacgcaccgttcaagaggtacgcgtatagagccgtatagagcagagacggagcactttctggtactgtccgcacgggatgtccgcacggagagccacaaacgagcggggccccgtacgtgctctcctaccccaggatcgcatccccgcatagctgaacatctatataaagacccccaaggttctcagtctcaccaacatcatcaaccaacaatcaacagttctctactcagttaattagaactcttccaatcctatcacctcgcctcaaatactagagaaagaggagaaatactagatgagtgtgatcgctaaacaaatgacctacaaggtttatatgtcaggcacggtcaatggacactactttgaggtcgaaggcgatggaaaaggtaagccctacgagggggagcagacggtaaagctcactgtcaccaagggcggacctctgccatttgcttgggatattttatcaccacagtgtcagtacggaagcataccattcaccaagtaccctgaagacatccctgactatgtaaagcagtcattcccggagggctatacatgggagaggatcatgaactttgaagatggtgcagtgtgtactgtcagcaatgattccagcatccaaggcaactgtttcatctaccatgtcaagttctctggtttgaactttcctcccaatggacctgtcatgcagaagaagacacagggctgggaacccaacactgagcgtctctttgcacgagatggaatgctgctaggaaacaactttatggctctgaagttagaaggaggcggtcactatttgtgtgaatttaaaactacttacaaggcaaagaagcctgtgaagatgccagggtatcactatgttgaccgcaaactggatgtaaccaatcacaacaaggattacacttcggttgagcagtgtgaaatttccattgcacgcaaacctgtggtcgcctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z