BBa_K2095000 1 BBa_K2095000 pLIP (SORLIPx2) 2016-10-08T11:00:00Z 2016-10-15T08:33:29Z Dunaliella sp. This basic part consists of a synthesised truncated version of the promotor of the light-inducible protein gene (LIP) in Dunaliella microalgae. Activation of the promoter has shown to be stimulated by high intensity light when introduced into Chlamydomonas Reinhardtii (1)(2). In 2013, Park S. et al. investigated the promoter of the highly inducible promoter gene (LIP) of the marine algae Dunaliella sp.(1). They discovered several light-responsive motifs by experimenting with truncations of the promotor fused with a Renilla luciferase gene introduced in C. reinhardtii. In a more recent study from 2016, they identified sequences over-represented in light-inducible promoters (SORLIP)(2). Duplication of the SORLIP sequence upstream a 100 bp truncation of the LIP promoter showed promising results in activity when stimulated by high- and medium-intensity light. This BioBrick consists of the 2xSORLIP promotor sequence followed by an intron, optimized for use C. reinhardtii. 1. Park S, Lee Y, Lee J-H, Jin E. Expression of the high light-inducible Dunaliella LIP promoter in Chlamydomonas reinhardtii. Planta [Internet]. 2013 Dec [cited 2016 Sep 4];238(6):1147???56. Available from: http://www.ncbi.nlm.nih.gov/pubmed/24043576 2. Baek K, Lee Y, Nam O, Park S, Sim SJ, Jin E. Introducing Dunaliella LIP promoter containing light-inducible motifs improves transgenic expression in Chlamydomonas reinhardtii. Biotechnol J. 2016;11(3):384???92. false false _2563_ 31143 31143 9 false The intron was added to improve gene expression in C. reinhardtii, but is not necessarily vital for its function. false Liu iGEM annotation2489053 1 SORLIPx2 range2489053 1 5 144 BBa_K2095000_sequence 1 gcgcgggctccgggccaccggagcgtgagggctccgggccacacatttgccagcctgaaaacttgccaaaaaccactcatcatcaaaacaacaaaagcttcaatcaaaactcgttcctacacccacacgaaccgacccgaacaggccaggtgagtcgacgagcaagcccggcggatcaggcagcgtgcttgcagatttgacttgcaacgcccgcattgtgtcgacgaaggcttttggctcctctgtcgctgtctcaagcagcatctaaccctgcgtcgccgtttccatttgcaggaagcttgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z