BBa_K2097000 1 BBa_K2097000 CpxR binding site attached to a yellow-green color protein (YGCP) acts as a neutral pH indicator. 2016-09-12T11:00:00Z 2016-10-20T11:47:25Z The two parts together (CpxR binding site - YGCP) were ordered from IDT. The original sources for the CpxR binding site came from: "Involvement of cpxA, a Sensor of a Two-Component Regulatory System, in the pH-Dependent Regulation of Expression of Shigella sonnei virF Gene" http://www.ncbi.nlm.nih.gov/pmc/articles/PMC177285/pdf/1775062.pdf "Identification of cpxR as a Positive Regulator Essential for Expression of the Shigella sonnei virF Gene" http://www.ncbi.nlm.nih.gov/pmc/articles/PMC107317/pdf/jb003522.pdf GenBank used: http://www.ncbi.nlm.nih.gov/nuccore/CP000039.1?&feature=CDS The YGCP (Bba_K1033916) comes from the iGEM Registry. CpxA-CpxR is a two-component mechanism that is activated at pH 7.4 and repressed at pH 6.0. CpxA is an intermembrane protein that autophosphorylates at a certain external pH, CpxR (a kinase) then gets phosphorylated by CpxA and acts as a transcription factor. This system originally is a transcription factor for the virF gene, but we replaced virF with the Reporter. This reporter is a YGCP (Bba_K1033916). The original sequence was found in Shigella sonnei, but E. coli has a homolog of these proteins so all that is required on the construct is the appropriate prefix/suffix and CpxR binding site. false false _2565_ 32619 27948 9 false The sequence directly from the papers - "Involvement of cpxA, a Sensor of a Two-Component Regulatory System, in the pH-Dependent Regulation of Expression of Shigella sonnei virF Gene" (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC177285/pdf/1775062.pdf) and "Identification of cpxR as a Positive Regulator Essential for Expression of the Shigella sonnei virF Gene" (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC107317/pdf/jb003522.pdf) - was not used. We used the loci detailed in the papers and found the CpxR binding sequence in the GenBank to construct the sequenced used in the experiments. false Sofia Chinea annotation2492832 1 RBS range2492832 1 83 95 annotation2492828 1 Cpx-R Binding Site range2492828 1 1 82 annotation2492833 1 Bba_K1033916 range2492833 1 101 793 BBa_K2097000_sequence 1 aaaaatgtaaataaagttaaatataggaaaaattacttaatctatcttaataacggaaagattttgtatacaatcactgttaaaagaggagaaatactagatggcactgagcaacaagtttatcggtgatgatatgaaaatgacgtaccacatggacggctgcgtgaacggccactactttacggtgaaaggtgaaggcaacggtaaaccgtatgaaggcacccagacgagcacctttaaagttacgatggcgaatggcggtccgctggcctttagtttcgatattctgtccaccgtctttaaatacggcaaccgttgcttcacggcgtatccgaccagcatgccggattactttaagcaagccttcccggacggcatgtcttatgaacgcacgtttacctacgaagatggcggtgtggcgaccgccagctgggaaatttctctgaaaggcaactgtttcgaacataagagtacctttcacggcgtgaatttcccggcagatggtccggttatggctaaaaagaccacgggttgggacccgtcatttgaaaaaatgacggtctgcgatggcatcctgaagggtgacgtgaccgcatttctgatgctgcaaggcggcggcaattatcgttgtcaattccatacgtcctacaaaaccaaaaagccggttacgatgccgccgaaccatgtggttgaacaccgtattgcgcgcaccgatctggacaaaggtggcaattcagttcagctgacggaacatgcagtcgctcacatcacctcggtcgtgccgttctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z