BBa_K2100000 1 BBa_K2100000 pENTR pEREx3 2016-09-11T11:00:00Z 2016-09-26T04:43:15Z DNA sequence synthesized by IDT. pEREx3 is a synthetic mammalian promoter that responds to estrogen receptor activated by estradiol (E2). pEREx3 consists of three repeats of the estrogen response element (ERE) consensus sequence upstream of a minimal promoter (minCMV). We have demonstrated a 10-fold activation in MCF7 cells treated with nanomolar E2/EtOH concentrations when cascaded with eYFP. false false _2568_ 31606 31606 9 true Estrogen Side Promoter Design -ERE's are spaced within the locations of the TetO sites of the TRE inducible promoter. Additionally, since the tetO site is 19 base pairs and ERE is only 13 base pairs, we added 5 additional random and different base pairs upstream, directly in front of the ERE sequence, to maintain the geometry of the TRE promoter since the way the DNA folds is important and we didn't want the DNA to misfold by having an incorrect length. -ERE sequence has three blank base pairs in the middle of its sequence, which we chose to fill randomly and differently for each occurence of an ERE site since there is no indication that they have any effect on the functionality of the binding to ER-alpha and also because IDT would not synthesize it with so many repeated sequences. -Chose repetitions of 3,5, and 6 because the paper had most success with 3 synthetic EREs, then five was a middle number, and 6 is the number of TetO sites on TRE-tight that we wanted to mimic since that was a successful synthetically built inducible promoter. -Choose pTFF1 because that is a natural promoter that responds to ER-alpha. -We additionally liked the fact that the synthetic pEREs drastically shortened the length of promoter from the 2000+ base pairs of pTFF1. -We also decided to try to synthesize an inducible promoter rather than doing the fusion with VP16-GAL4 (like the progesterone side) since we wanted to maintain and utilize as many natural components of the cell itself. false Kathleen Brandes annotation2483262 1 ERE site range2483262 1 49 60 annotation2483263 1 ERE site range2483263 1 82 93 annotation2483261 1 ERE site range2483261 1 15 26 annotation2483260 1 minCMV range2483260 1 113 168 BBa_K2100000_sequence 1 gctccgaattcgcgcggtcaacatgaccacgtatgtcgagtttattgcatggtcatcatgaccacgtatgtcgagtttactatcgcggtcagactgaccacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgaccgaattcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z