BBa_K2100004 1 BBa_K2100004 pENTR pTRE 2016-10-09T11:00:00Z 2016-10-10T09:55:39Z This is a synthetic promoter. description here! false false _2568_ 31606 31606 9 false This part was created using scarless golden gate assembly. This basic part is flanked by L1 and L2 sites and can be easily cloned into an entry vector using an LR reaction. A promoter can be easily inserted in front of this part in a one pot LR reaction with a promoter flanked by L4 and R1 sites cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes annotation2490247 1 tetO binding site range2490247 1 187 201 annotation2490243 1 tetO binding site range2490243 1 150 164 annotation2490244 1 tetO binding site range2490244 1 222 236 annotation2490227 1 tetO binding site range2490227 1 77 91 annotation2490245 1 tetO binding site range2490245 1 44 58 annotation2490217 1 minCMV range2490217 1 253 312 annotation2490246 1 tetO binding site range2490246 1 116 130 BBa_K2100004_sequence 1 gctccgaattcgcccttcaggtccgaggttctagacgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z