BBa_K2100008 1 BBa_K2100008 pENTR pPRE3 2016-10-09T11:00:00Z 2016-10-10T09:57:09Z This is a synthetic promoter from IDT. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L4 and R1 sites, which are used to denote a promoter. This can be cascade with a gene (flanked by L1, L2 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes annotation2490329 1 minCMV range2490329 1 142 202 annotation2490336 1 PRE site range2490336 1 114 129 annotation2490330 1 PRE site range2490330 1 40 55 annotation2490337 1 PRE site range2490337 1 76 91 BBa_K2100008_sequence 1 aggctaggtctcaaggtacgtatgtcgagtttactttcacgggacgtggtgttctacgtatgtcgagtttatttcacgggacgtggtgttctacgtatgtcgagtttactttcacgggacgtggtgttctacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgacgctttgagaccagacct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z