BBa_K2100009 1 BBa_K2100009 pENTR pPRE4 2016-10-09T11:00:00Z 2016-10-10T09:57:26Z This is a synthetic promoter from IDT. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L4 and R1 sites, which are used to denote a promoter. This can be cascade with a gene (flanked by L1, L2 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes annotation2490376 1 minCMV range2490376 1 184 241 annotation2490385 1 PRE site range2490385 1 121 136 annotation2490387 1 PRE site range2490387 1 157 172 annotation2490384 1 PRE site range2490384 1 50 65 annotation2490386 1 PRE site range2490386 1 86 101 BBa_K2100009_sequence 1 gctccgaattcgaggctaggtctcaaggtgtatgtcgagtttactaacgcgggacatggtgttctgtatgtcgagtttactttgtaggtacatggtgttctgtaagtcgagtttattttgcaggacatggtgttctgtatgtcgagtttactttgacggtacgtggtgttctgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgacgctttgagaccagacctcgaattcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z