BBa_K2100010 1 BBa_K2100010 pENTR pHybrid 2016-10-09T11:00:00Z 2016-10-10T09:45:48Z This is a synthetic promoter from IDT. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L4 and R1 sites, which are used to denote a promoter. This can be cascade with a gene (flanked by L1, L2 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes annotation2490407 1 PRE site range2490407 1 64 79 annotation2490412 1 PRE site range2490412 1 209 224 annotation2490413 1 ERE site range2490413 1 47 60 annotation2490410 1 PRE site range2490410 1 136 151 annotation2490406 1 minCMV range2490406 1 234 292 annotation2490417 1 ERE site range2490417 1 193 206 annotation2490411 1 PRE site range2490411 1 173 188 annotation2490409 1 PRE site range2490409 1 100 115 annotation2490415 1 ERE site range2490415 1 119 132 annotation2490416 1 ERE site range2490416 1 156 169 annotation2490414 1 ERE site range2490414 1 84 97 BBa_K2100010_sequence 1 gctccgaattcacctgctgacaggtacgatgtcgagtttactcctatggtcaaaatgaccacgtgggacgtggtgttctacgcggtcacattgaccacgtgggacatggtgttcttgtaggtcaggctgaccacgtggtacatggtgttcttttgcggtcagtatgaccacgtaggacatggtgttcttgacggtcatattgaccacgtggtacgtggtgttctatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgacgcttcagtgcaggtgagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z