BBa_K2100024 1 BBa_K2100024 pENTR pTAL14 2016-10-13T11:00:00Z 2016-10-14T05:24:59Z This is from the mammalian genome. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L4 and R1 sites, which are used to denote a promoter. This can be cascade with a gene (flanked by L1, L2 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes BBa_K2100024_sequence 1 gctccgaattcacctgctgacaggtgatctcatgtgattacgccaagctacgggcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccgagcggagactctagatacccctctccgcttctgaattctaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctcgagtacccctctccgcttcttacccctctccgcttcttacccctctccgcttctggatccaattcgcttggtctcggcttcagtgcaggtgagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z