BBa_K2100024 1 BBa_K2100024 pENTR pTAL14 2016-10-13T11:00:00Z 2016-10-14T05:24:59Z This is from the mammalian genome. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L4 and R1 sites, which are used to denote a promoter. This can be cascade with a gene (flanked by L1, L2 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes BBa_K2100001 1 BBa_K2100001 pENTR pEREx5 2016-09-25T11:00:00Z 2016-09-26T05:07:50Z No, this a part synthesized by IDT. TBD. false false _2568_ 31606 31606 9 false Like TRE (ELABORATE HERE) false Kathleen Brandes annotation2485068 1 ERE site range2485068 1 140 151 annotation2485065 1 ERE site range2485065 1 33 44 annotation2485066 1 ERE site range2485066 1 67 78 annotation2485067 1 ERE site range2485067 1 107 118 annotation2485070 1 minCMV range2485070 1 204 259 annotation2485069 1 ERE site range2485069 1 173 184 BBa_K2100034 1 BBa_K2100034 pEXPR pERE5:TALER14 2016-10-16T11:00:00Z 2016-10-17T04:24:04Z This is a synthetic promoter and a gene from the mammalian genome. description here. false false _2568_ 31606 31606 9 false This composite part expression vector was created by an LR reaction via gateway cloning. It is a promoter (flanked by L4, R1 sites) and a gene (flanked by L1, L2 sites) cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes component2515495 1 BBa_K2100024 component2515494 1 BBa_K2100001 annotation2515495 1 BBa_K2100024 range2515495 1 298 641 annotation2515494 1 BBa_K2100001 range2515494 1 1 289 BBa_K2100034_sequence 1 gctccgaattcgacgatgtcgagtttactcctatggtcaaaatgaccacgtatgtcgagtttactaacgcggtcacattgaccacgtatgtcgagtttactttgtaggtcaggctgaccacgtatgtcgagtttattttgcggtcagtatgaccacgtatgtcgagtttactttgacggtcatattgaccacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgaccgaattcgactactagaggctccgaattcacctgctgacaggtgatctcatgtgattacgccaagctacgggcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccgagcggagactctagatacccctctccgcttctgaattctaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctcgagtacccctctccgcttcttacccctctccgcttcttacccctctccgcttctggatccaattcgcttggtctcggcttcagtgcaggtgagctt BBa_K2100024_sequence 1 gctccgaattcacctgctgacaggtgatctcatgtgattacgccaagctacgggcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccgagcggagactctagatacccctctccgcttctgaattctaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctcgagtacccctctccgcttcttacccctctccgcttcttacccctctccgcttctggatccaattcgcttggtctcggcttcagtgcaggtgagctt BBa_K2100001_sequence 1 gctccgaattcgacgatgtcgagtttactcctatggtcaaaatgaccacgtatgtcgagtttactaacgcggtcacattgaccacgtatgtcgagtttactttgtaggtcaggctgaccacgtatgtcgagtttattttgcggtcagtatgaccacgtatgtcgagtttactttgacggtcatattgaccacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgaccgaattcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z