BBa_K2100024 1 BBa_K2100024 pENTR pTAL14 2016-10-13T11:00:00Z 2016-10-14T05:24:59Z This is from the mammalian genome. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L4 and R1 sites, which are used to denote a promoter. This can be cascade with a gene (flanked by L1, L2 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes BBa_K2100035 1 BBa_K2100035 pEXPR pERE6:TALER14 2016-10-16T11:00:00Z 2016-10-17T04:28:19Z This is a synthetic promoter with a gene from the mammalian genome. description here. false false _2568_ 31606 31606 9 false This composite part expression vector was created by an LR reaction via gateway cloning. It is a promoter (flanked by L4, R1 sites) and a gene (flanked by L1, L2 sites) cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes component2515523 1 BBa_K2100024 component2515522 1 BBa_K2100002 annotation2515523 1 BBa_K2100024 range2515523 1 360 703 annotation2515522 1 BBa_K2100002 range2515522 1 1 351 BBa_K2100002 1 BBa_K2100002 pENTR pEREx6 2016-09-25T11:00:00Z 2016-09-26T05:30:15Z Synthesized by IDT. Sequence given b/n L4 R1 sites TBD @ Archis false false _2568_ 31606 31606 9 false Like TRE yay false Kathleen Brandes annotation2485077 1 ERE site range2485077 1 204 215 annotation2485080 1 ERE site range2485080 1 59 70 annotation2485082 1 ERE site range2485082 1 165 177 annotation2485079 1 minCMV range2485079 1 263 323 annotation2485081 1 ERE site range2485081 1 91 102 annotation2485078 1 ERE site range2485078 1 238 250 annotation2485076 1 ERE site range2485076 1 131 142 BBa_K2100035_sequence 1 gctccgaattcggctccgaattcgcccttcaggtccgaggttctagacgagtttacttggaggtcattatgaccacgatgtcgagtttacatgcgcggtcagagtgaccacgtatgtcgagtttactcccacggtcatgatgaccacgtatgtcgagtttacttggttggtcagattgaccacgtatgtcgagtttataattcggtcatttcgaccacgtatgtcgagtttactttcacggtcaggatgaccacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgaccgaattcgactactagaggctccgaattcacctgctgacaggtgatctcatgtgattacgccaagctacgggcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccgagcggagactctagatacccctctccgcttctgaattctaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctcgagtacccctctccgcttcttacccctctccgcttcttacccctctccgcttctggatccaattcgcttggtctcggcttcagtgcaggtgagctt BBa_K2100024_sequence 1 gctccgaattcacctgctgacaggtgatctcatgtgattacgccaagctacgggcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccgagcggagactctagatacccctctccgcttctgaattctaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcctcgagtacccctctccgcttcttacccctctccgcttcttacccctctccgcttctggatccaattcgcttggtctcggcttcagtgcaggtgagctt BBa_K2100002_sequence 1 gctccgaattcggctccgaattcgcccttcaggtccgaggttctagacgagtttacttggaggtcattatgaccacgatgtcgagtttacatgcgcggtcagagtgaccacgtatgtcgagtttactcccacggtcatgatgaccacgtatgtcgagtttacttggttggtcagattgaccacgtatgtcgagtttataattcggtcatttcgaccacgtatgtcgagtttactttcacggtcaggatgaccacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgaccgaattcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z