BBa_K2100022 1 BBa_K2100022 pENTR pBM3R1 2016-10-13T11:00:00Z 2016-10-14T05:16:04Z This is from a mammalian genome. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L4 and R1 sites, which are used to denote a promoter. This can be cascade with a gene (flanked by L1, L2 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes BBa_K2100004 1 BBa_K2100004 pENTR pTRE 2016-10-09T11:00:00Z 2016-10-10T09:55:39Z This is a synthetic promoter. description here! false false _2568_ 31606 31606 9 false This part was created using scarless golden gate assembly. This basic part is flanked by L1 and L2 sites and can be easily cloned into an entry vector using an LR reaction. A promoter can be easily inserted in front of this part in a one pot LR reaction with a promoter flanked by L4 and R1 sites cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes annotation2490244 1 tetO binding site range2490244 1 222 236 annotation2490246 1 tetO binding site range2490246 1 116 130 annotation2490245 1 tetO binding site range2490245 1 44 58 annotation2490227 1 tetO binding site range2490227 1 77 91 annotation2490243 1 tetO binding site range2490243 1 150 164 annotation2490217 1 minCMV range2490217 1 253 312 annotation2490247 1 tetO binding site range2490247 1 187 201 BBa_K2100036 1 BBa_K2100036 pEXPR TRE-BM3R1 2016-10-16T11:00:00Z 2016-10-17T04:56:40Z Part comes from some genomic sequence. This part is the result of an LR combining a tet response element promoter (TRE) and the repressor BM3R1. The repressor can bind to sites on the BM3R1 promoter. false false _2568_ 32888 32888 9 false None false Wangui Mbuguiro component2515608 1 BBa_K2100022 component2515607 1 BBa_K2100004 annotation2515607 1 BBa_K2100004 range2515607 1 1 330 annotation2515608 1 BBa_K2100022 range2515608 1 339 589 BBa_K2100022_sequence 1 gctgcggccgcgaacggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccgggtctcagctagctcggaatgaacgttcattccgacgccgataggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcgacaccggaatgaacgttcattccggggtctcggaattcgagc BBa_K2100004_sequence 1 gctccgaattcgcccttcaggtccgaggttctagacgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgac BBa_K2100036_sequence 1 gctccgaattcgcccttcaggtccgaggttctagacgagtttactccctatcagtgatagagaacgatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgagtttatccctatcagtgatagagaacgtatgtcgagtttactccctatcagtgatagagaacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgactactagaggctgcggccgcgaacggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagtactgtcctccgagcggagttctgtcctccgggtctcagctagctcggaatgaacgttcattccgacgccgataggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcgacaccggaatgaacgttcattccggggtctcggaattcgagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z