BBa_K2100000 1 BBa_K2100000 pENTR pEREx3 2016-09-11T11:00:00Z 2016-09-26T04:43:15Z DNA sequence synthesized by IDT. pEREx3 is a synthetic mammalian promoter that responds to estrogen receptor activated by estradiol (E2). pEREx3 consists of three repeats of the estrogen response element (ERE) consensus sequence upstream of a minimal promoter (minCMV). We have demonstrated a 10-fold activation in MCF7 cells treated with nanomolar E2/EtOH concentrations when cascaded with eYFP. false false _2568_ 31606 31606 9 true Estrogen Side Promoter Design -ERE's are spaced within the locations of the TetO sites of the TRE inducible promoter. Additionally, since the tetO site is 19 base pairs and ERE is only 13 base pairs, we added 5 additional random and different base pairs upstream, directly in front of the ERE sequence, to maintain the geometry of the TRE promoter since the way the DNA folds is important and we didn't want the DNA to misfold by having an incorrect length. -ERE sequence has three blank base pairs in the middle of its sequence, which we chose to fill randomly and differently for each occurence of an ERE site since there is no indication that they have any effect on the functionality of the binding to ER-alpha and also because IDT would not synthesize it with so many repeated sequences. -Chose repetitions of 3,5, and 6 because the paper had most success with 3 synthetic EREs, then five was a middle number, and 6 is the number of TetO sites on TRE-tight that we wanted to mimic since that was a successful synthetically built inducible promoter. -Choose pTFF1 because that is a natural promoter that responds to ER-alpha. -We additionally liked the fact that the synthetic pEREs drastically shortened the length of promoter from the 2000+ base pairs of pTFF1. -We also decided to try to synthesize an inducible promoter rather than doing the fusion with VP16-GAL4 (like the progesterone side) since we wanted to maintain and utilize as many natural components of the cell itself. false Kathleen Brandes annotation2483262 1 ERE site range2483262 1 49 60 annotation2483263 1 ERE site range2483263 1 82 93 annotation2483261 1 ERE site range2483261 1 15 26 annotation2483260 1 minCMV range2483260 1 113 168 BBa_K2100042 1 BBa_K2100042 pEXPR pERE3:BM3R1 2016-10-16T11:00:00Z 2016-10-17T07:39:59Z This is a synthetic promoter with a gene from a mammalian genome. description here. false false _2568_ 31606 31606 9 false This composite part expression vector was created by an LR reaction via gateway cloning. It is a promoter (flanked by L4, R1 sites) and a gene (flanked by L1, L2 sites) cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes component2516090 1 BBa_K2100000 component2516091 1 BBa_K2100018 annotation2516090 1 BBa_K2100000 range2516090 1 1 198 annotation2516091 1 BBa_K2100018 range2516091 1 207 842 BBa_K2100018 1 BBa_K2100018 pENTR BM3R1 2016-10-13T11:00:00Z 2016-10-14T04:48:06Z This is from a mammalian genome. description here. false false _2568_ 31606 31606 9 false This basic part entry vector is flanked by L1 and L2 sites, which are used to denote a gene. This can be cascade with a promoter (flanked by L4, R1 sites) using an LR reaction and cloning into a cloned into a backbone that has a negative selection marker between R4 and R2 sites. This part adheres to RFC 65 for recombination based cloning of mammalian parts. false Kathleen Brandes BBa_K2100042_sequence 1 gctccgaattcgcgcggtcaacatgaccacgtatgtcgagtttattgcatggtcatcatgaccacgtatgtcgagtttactatcgcggtcagactgaccacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgaccgaattcgactactagaggctgagccaccatggaaagcacccccaccaagcagaaggccatcttcagcgccagcctgctgctgttcgccgagagaggctttgacgccaccaccatgcccatgattgccgagaacgccaaagtgggagccggcaccatctaccggtacttcaagaacaaagagagcctggtcaacgagctgttccagcagcacgtgaacgagtttctgcagtgcatcgagagcggcctggccaatgagagggacggctacagagatggcttccaccacatcttcgagggcatggtcaccttcaccaagaaccaccccagagccctgggcttcatcaagacccacagccagggcacctttctgaccgaggaaagccggctggcctaccagaaactggtggaattcgtgtgcaccttcttcagagagggccagaaacagggcgtgatccggaacctgcccgagaatgccctgatcgccatcctgttcggcagcttcatggaagtgtacgagatgatcgagaacgactacctgagcctgaccgacgagctgctgaccggcgtggaagaatctctgtgggccgctctgagcagacagagcgccagcccccccaagaaaaagcggaaagtgtgatgagctagctgatacc BBa_K2100018_sequence 1 gctgagccaccatggaaagcacccccaccaagcagaaggccatcttcagcgccagcctgctgctgttcgccgagagaggctttgacgccaccaccatgcccatgattgccgagaacgccaaagtgggagccggcaccatctaccggtacttcaagaacaaagagagcctggtcaacgagctgttccagcagcacgtgaacgagtttctgcagtgcatcgagagcggcctggccaatgagagggacggctacagagatggcttccaccacatcttcgagggcatggtcaccttcaccaagaaccaccccagagccctgggcttcatcaagacccacagccagggcacctttctgaccgaggaaagccggctggcctaccagaaactggtggaattcgtgtgcaccttcttcagagagggccagaaacagggcgtgatccggaacctgcccgagaatgccctgatcgccatcctgttcggcagcttcatggaagtgtacgagatgatcgagaacgactacctgagcctgaccgacgagctgctgaccggcgtggaagaatctctgtgggccgctctgagcagacagagcgccagcccccccaagaaaaagcggaaagtgtgatgagctagctgatacc BBa_K2100000_sequence 1 gctccgaattcgcgcggtcaacatgaccacgtatgtcgagtttattgcatggtcatcatgaccacgtatgtcgagtttactatcgcggtcagactgaccacgtatgtcgaggtaggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcgcaaagggcgaattcgaccgaattcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z