BBa_K210013 1 BBa_K210013 LacI binding sites' tandem sequence #700 2009-10-14T11:00:00Z 2015-05-08T01:11:29Z primer This is a tandem sequence of lacI binding sites(GAAATGTGAGCGCTCACAACT). In the project "Time bomb" of iGEM Kyoto 2009, this part was used in order to stbilize linear DNA. It is very difficult to clone this parts because tandem sequence can induce mutation. So, if you want to use this parts, you should cloning this under 32C under which it is liower possible that mutation happens. false false _346_ 0 5425 9 No part sequence false This parts was made by MPR. Due to mutation, we could not suceed to sequence. We confirmed this has only one set of EcoR1, Xba1, Spe1 and Pst1 recognition sites. false Makoto Kashima igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z