BBa_K2107001 1 BBa_K2107001 Stationary Phase Promoter + Kil Protein 2016-10-18T11:00:00Z 2016-10-24T10:47:03Z GAA TTC GCG GCC GCT TCT AGA GCA ATC TTG CCC GCG CTT CTG CTC TCC CGG CGT AAC CCG GAT TTG CCG CTT ATA CTT GTG GCA AAT GGA CAC GTT CAG GGA GTA GAG AAA GAG GGA CAA ACT AGT ATG ATG CGT AAC GAA ATC GCG ATC AAC CAC CAG ATG CTG CGT GCG GCG CAG AAC AAA GCG GTT ATC GCG CGT TTC ATC GGT GAC TCT AAA ATG TGG CTG GAA GCG AAC AAA GCG ATG AAA TCT GCG ATC AAC CTG CCG TGG TAC CGT CGT AAA TAA TGA TAC TAG TAG CGG CCG CTG CAG This Biobrick is a composite part that is made up of a stationary phase induced promoter, followed by a gene coding region for Kil protein. This part is intended to be used for in-line protein purification systems or a Kill switch. When a bacteria containing this part reaches stationary phase it will begin producing Kil protein which has been shown to degrade the outermost membrane, ultimately releasing the contents of the periplasm into the supernatant. A protein of interest could be cloned into a separate vector with a periplasm localization signal and purified from the supernatant after release by the Kil protein. This method would result in cleaner purification in comparison to traditional methods such as cell lysis. If the concentration of Kil protein reaches to high of a level it can also cause cell death. false false _2575_ 30500 30500 9 false This part should be cloned into a low to medium copy plasmid for the best expression. false Ellen Wilson BBa_K2107001_sequence 1 caatcttgcccgcgcttctgctctcccggcgtaacccggatttgccgcttatacttgtggcaaatggacacgttcagggagtagagaaagagggacaaactagtatgatgcgtaacgaaatcgcgatcaaccaccagatgctgcgtgcggcgcagaacaaagcggttatcgcgcgtttcatcggtgactctaaaatgtggctggaagcgaacaaagcgatgaaatctgcgatcaacctgccgtggtaccgtcgtaaataatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z