BBa_K2109110 1 BBa_K2109110 HDVR U1A-C75T 2016-10-13T11:00:00Z 2016-10-28T01:08:19Z n/a to be filled false false _2577_ 17031 17031 9 false n/a false Andy Hudson annotation2530601 1 U1A-C75T Herpes Delta Virus Ribozmye range2530601 1 56 128 annotation2530603 1 RFC 10 scar sequence range2530603 1 129 137 annotation2530560 1 T7 promoter range2530560 1 1 20 annotation2530600 1 MS2 binding region range2530600 1 27 47 annotation2530604 1 double terminator (B0015) range2530604 1 138 266 BBa_K2109110_sequence 1 taatacgactcactatagggaatattaacatgaggatcacccatgtattgagagatggccggcatggtcccagcctcctcgctggcgccggctgggcaacaccattgcactccggtggtgaatgggacctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z