BBa_K2110001 1 BBa_K2110001 TPA inducible Leader sequence (TILS) 2016-10-04T11:00:00Z 2016-10-05T07:09:55Z It comes from the genome of RhodococcusjostiiRHA1. This sequence comes from RhodococcusjostiiRHA1. Rhodococcus owns the ability of degrading terephthalic acid (TPA), this pathway is regulated by many genes and some of them can be induced by TPA. The inducing effect is based on a regulatory proteintpaR, which can bind this sequence at the existence of TPA and induce the expression of downstream gene. This sequence should be placed before the sequence of promoter. false false _2578_ 32957 32957 9 false This sequence is very short so if the gel recycling is necessary, the agarose concentration should be increased. false Le He annotation2486062 1 BioBrick range2486062 1 1 96 BBa_K2110001_sequence 1 aatttctcctcagtctggacaaccagtcgggacatcagagaactcgctcggcgggacttgacaagccccgtggctgttcgtataacgaacatatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z