BBa_K135000 1 BBa_K135000 pCpxR (CpxR responsive promoter) 2008-10-19T11:00:00Z 2015-05-08T01:10:01Z This part comes from the genome of E.coli TR235, as used in the PNAS paper of Otto and Silhavy mentioned previously. TR235 is K-12 MC4100 containing a pCpxR-LacZ fusion inserted at the (Lambda)att site, plus some other modifications (see Otto and Silhavy). The part is a portion of the CpxR responsive region used in these LacZ fusions. This is suggested to be an adhesion responsive promoter. It contains the binding site for CpxR-P (phosphorylated CpxR). CpxR is one member of the two-component Cpx response to envelope stress. Briefly, envelope stress causes CpxA, an inner-membrane histidine Kinase to Phosphorylate CpxR, allowing it to bind to CpxR-P responsive regions and regulate downstream target genes. See 'Surface sensing and adhesion of Escherichia coli controlled by the Cpx-signaling pathway', Karen Otto and Thomas J. Silhavy, PNAS, Vol. 99., No, 4., 2287-2292. 2002. false false _183_ 0 2796 9 It's complicated false None false Oliver Purcell annotation1982751 1 CpxR-P Binding site range1982751 1 1 15 annotation1982752 1 BBa_K135000 range1982752 1 1 55 BBa_K2110008 1 BBa_K2110008 inclusion body induced cell lysis system 2016-10-05T11:00:00Z 2016-10-12T09:13:08Z BBa_K135000 BBa_B0034 BBa_K2110004 Long Description: This part consists of theCpxR responsive promoter (Part:BBa_K135000), a RBS (Part:BBa_B0034), ddpX gene (Part: BBa_K2110004), two terminators (Part:BBa_B0010, Part:BBa_B0012). The CpxR responsive promoter can response to the inclusion body and misfold protein in the periplasm. When this system coexpress with an exogenous gene like the PETase gene, the forming inclusion body will induce the expression of downstream ddpX gene and cause the cell lysis, which provides much convenience to the purification steps followed. false false _2578_ 32964 32957 9 true / false Le He component2486555 1 BBa_K2110004 component2486553 1 BBa_B0034 component2486551 1 BBa_K135000 annotation2486551 1 BBa_K135000 range2486551 1 1 55 annotation2486553 1 BBa_B0034 range2486553 1 64 75 annotation2486555 1 BBa_K2110004 range2486555 1 84 665 BBa_K2110004 1 BBa_K2110004 D-alanyl-D-alanine dipeptidase gene 2016-10-04T11:00:00Z 2016-10-05T11:21:26Z It comes from the genome of E.coli Peptidoglycan is the major constituent of cell wall of bacterial like E.coli. The D-alanyl-D-alanine dipeptidase gene (ddpX) exists in the genome of E.coli. The counterpart of ddpX, VanX, which has the same effect as ddpX, exists in many gram-positive bacterial like Enterococcus faecalis and Streptomyces toyocaensis because they need it to hydrolyze the D-Ala-D-Ala and transfer the D-Ala-D-Ala residue of peptidoglycan to D-Ala-D-Lac residue so that the antibiotic vancomycin cannot combine the peptidoglycan to cause the destruction of cell wall. However, in gram-negative bacterial like E.coli, which own the robust outer membrane that can resist the vancomycin, the hydrolase ddpX with the same effects also exists. This is strange because the gram-negative bacterial have no necessity to own this kind of seemly dangerous hydrolase. Actually the ddpX in E.coli has another vital use when they are under starvation conditions. The ddpX can hydrolyze the D-Ala-D-Ala in their cell wall to produce the D-Ala as the carbon source to maintain their life. This mechanism is only carried out when they are under starvation conditions. If the ddpX gene is overexpressed, the cell wall will be damaged and cell lysis will occur. false false _2578_ 32957 32957 9 false Enhanced promoter is required false Le He annotation2486167 1 BioBrick range2486167 1 1 582 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K2110008_sequence 1 gtaaaacaacgtaaagtcatggattagcgacgtctgatgacgtaatttctgcctctactagagaaagaggagaaatactagagttaactgacgtgctgtgtgccaggggatataaaacaagagaattgatcagcgagcagagggtaactcgctgcctggggtaattcgaagtgccaccattcgctggagataccgacaaaaccgccaccagtcattatcgcattcagcaacagccgattgcgctgagcggcgggcgggacggaagggtgataggcatgggagcgctcgtgcatttcatcgaaccctgcgcccatatcgaggatgttcccgtgctcatcacgaagcgtcaggtcgatcgccgtgccacggctgtgattagaaccgaccgtcacatcaacaacatattgcgggtctgggcaggcttgccacaacatcgcctgtgcttgttgtgggcgatacgcatcgtaaatcaccagttgtaaccctgacagctgggcgatgctgatacttttcgccagcgcggtaatcgcatccttgtgtaacagacaacgcgcttgctgataaatagctttacctgtgatgttatcagcgcaggcgtatttcaattcgatctccagatcagggaagattacggctaaatcaaccagttcggtggtatccgacat BBa_K2110004_sequence 1 ttaactgacgtgctgtgtgccaggggatataaaacaagagaattgatcagcgagcagagggtaactcgctgcctggggtaattcgaagtgccaccattcgctggagataccgacaaaaccgccaccagtcattatcgcattcagcaacagccgattgcgctgagcggcgggcgggacggaagggtgataggcatgggagcgctcgtgcatttcatcgaaccctgcgcccatatcgaggatgttcccgtgctcatcacgaagcgtcaggtcgatcgccgtgccacggctgtgattagaaccgaccgtcacatcaacaacatattgcgggtctgggcaggcttgccacaacatcgcctgtgcttgttgtgggcgatacgcatcgtaaatcaccagttgtaaccctgacagctgggcgatgctgatacttttcgccagcgcggtaatcgcatccttgtgtaacagacaacgcgcttgctgataaatagctttacctgtgatgttatcagcgcaggcgtatttcaattcgatctccagatcagggaagattacggctaaatcaaccagttcggtggtatccgacat BBa_K135000_sequence 1 gtaaaacaacgtaaagtcatggattagcgacgtctgatgacgtaatttctgcctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z