BBa_K2110009 1 BBa_K2110009 phage P22 holins 2016-10-04T11:00:00Z 2016-10-05T11:17:59Z genome P22 holin gene, with start and stop codons. Holins are small membrane proteins that produce nonspecific lesions (holes) in the cytoplasmic membrane from within, allow the endolysins and auxiliary lysis factors to gain access to the polypeptidoglycan layers, and trigger the lysis process. false false _2578_ 0 32957 32957 9 It's complicated false / false Le He BBa_K2110009_sequence 1 atgaaaaagatgccagaaaaacatgatctgttaaccgccatgatggcggcaaaggaacagggcatcggggcaatccttgcgtttgcaatggcgtaccttcgcggtcggtataatggcggtgcgtttaagaaaacactaatagacgcaacgatgtgcgccattatcgcctggttcattcgtgaccttttagtcttcgccggactgagtagcaatcttgcttacatagcgagtgtgtttatcggctacatcggcacagactcgattggttcgctaatcaaacgcttcgctgctaaaaaagccggagtcgatgatgcaaatcagcagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z