BBa_K2110017 1 BBa_K2110017 α-factor signal peptide 2016-10-05T11:00:00Z 2016-10-13T02:37:36Z Genome of Saccharomyces cerevisiae This sequence encodes the α-factor signal peptide. This peptide helps the secretion of α-factor of Saccharomyces cerevisiae. Attaching it before the protein can realize the secretion of protein in Saccharomyces cerevisiae. false false _2578_ 32964 32957 9 false / false Le He annotation2496602 1 misc range2496602 1 1 267 BBa_K2110017_sequence 1 agcttcagcctctcttttatccaaagataccccttcttctttagcagcaatgctggcaatagtagtatttataaacaataacccgttatttgtgctgttggaaaatggcaaaacagcaacatcgaaatccccttctaaatccaagtaaccgatgacagcttcagccggaatttgtgcggtttcatcttctgttgtagtgttgactggagcagctaatgcggaggatgctgcgaataaaacggcagtaaaaattgaaggaaatctcat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z