BBa_K2110839 1 BBa_K2110839 PETase site mutation S242I - F 2016-10-04T11:00:00Z 2016-10-11T07:47:08Z Artificially Designed This is the forward primer for mutant PETase. Site S242 was designed to be replaced by I242. The original codon optimized sequence codes the wild type protein called PETase. PETase is a Poly(ethylene terephthalate) hydrolase, which was found in Ideonella sakaiensis (strain 201-F6) by Japanese scientists. It allows Ideonella sakaiensis to degrade PET. If properly transferred into engineered organisms as E.Coli or yeast, secreted PETase can catalyze the hydrolysis of PET to produce mono(2-hydroxyethyl) terephthalate (MHET) as the major product. Optimum temperature is 40 degrees Celsius for PET film hydrolysis and optimum pH is 9. true false _2578_ 32964 32965 9 false First apply PCR for mutant section. Then PCR again with original primers of PETase to overlap for the entire mutant PETase. false Haipeng Yu BBa_K2110839_sequence 1 ttcttgtgctaacattggtaactctaaccaagcatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z