BBa_K2111000 1 BBa_K2111000 RI7_FLAG_OXTR 2016-10-18T11:00:00Z 2016-10-19T05:11:50Z The human oxytocin receptor sequence was found in the NCBI database, codon optimized for saccharomyce cerevisiae using http://www.jcat.de/ (with additional options to avoid cleavage sites EcoR1, Pst1, Spe1, Xba1. The sequence for the rat RI7 OR was found on the 2012 TU Delft iGEM team page and in Rhadhika 2007 (http://www.nature.com/nchembio/journal/v3/n6/full/nchembio882.html). This part is a chimeric receptor with a FLAG tag. It is composed of the ligand biding domain of the human oxytocin receptor, flanked by the N and C termini of the rat RI7 olfactory receptor. It was designed using the DIY receptor design guide created by the 2012 TU Delft iGEM team (http://2012.igem.org/Team:TU-Delft/receptordesign). This part is intended to express in the membrane of a yeast cell and - upon oxytocin ligand binding - activate the mating pathway and the inducible FUS1 promotor. This allows us to leverage a reporter protein under control of FUS1 to detect the presence of oxytocin. false false _2579_ 31485 31485 9 false We added a FLAG tag to facilitate SDS-PAGE. We added the yeast kozak sequence tacaaa to improve translation and codon optimized for saccharomyce cerevisiae. false Isaac Bean annotation2523800 1 RI7 N-terminus range2523800 1 34 213 annotation2524246 1 RI7 C-terminus range2524246 1 1018 1116 annotation2524242 1 Human Oxytocin Receptor Binding Site range2524242 1 214 1017 annotation2524445 1 Stop range2524445 1 1117 1122 annotation2524194 1 Start range2524194 1 7 9 annotation2523657 1 FLAG tag range2523657 1 10 33 annotation2522995 1 Kozak range2522995 1 1 6 BBa_K2111000_sequence 1 tacaaaatggactataaagatgacgatgataaggaacgtcgtaaccattccggtagagtgtctgagttcgtgttgttaggttttcccgcgccggccccccttcgtgtgttgctttttttcctgtctctactggcatatgtacttgtattaacggaaaacatgttgattattatagccatcagaaaccatcctactttacataagccgatgtataggacgacaagacaaaaacacagtcgtctatttttctttatgaagcatttaagtatagccgacttagtcgtcgctgtgtttcaggttctgccccagttactgtgggatattacattccgtttttacggccctgacttgctgtgtagattagtgaaatatctacaggtcgtaggtatgtttgcttcaacctatcttctattactaatgagtcttgatcgttgcttagctatatgccagccattgcgttcccttcgtaggaggacggatcgtcttgctgtccttgcgacgtggctaggctgtcttgtcgccagtgcaccgcaagtacatatcttcagtttacgtgaagtcgcggacggtgtctttgactgttgggcggtattcatccagccttggggtccaaaggcatacattacgtggattactctggccgtctatattgtgcctgtaatagttttggcagcatgttatggtctaatcagctttaagatctggcagaacctacgtctaaagactgctgccgctgcggctgctgaggctccggagggagcagctgccggggacggcggaagggtagccttggcacgtgtcagcagtgtaaaactaattagcaaagcaaaaataagaactgtgaagatgacattcattatcgttcttgccttcatcgtgtgttggacgcccttcttttttgtgcaaatgtggagtgtctgggatgcaaacgcaccaaaggaagcctcagcctttattattgtgatgttattggcgtcactaaacagttgttgcaatccctggatatacatgctgttctattgcttacgtaaccaagacgtcaaacgtgcgttaagaaggacgttacatctggcacaagatcaggaggcgaatactaataagggctctaagatcggctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z