BBa_K2111002 1 BBa_K2111002 FUS1 Promoter 2016-10-18T11:00:00Z 2016-10-19T06:59:22Z We used the sequence from BBa_K775004, with confirmation from the NCBI database for use in yeast strain S288c. The FUS1 promoter is from the yeast mating pathway. It is induced with pheromones from the opposite mating type. false false _2579_ 31485 31485 9 Not in stock false We confirmed that the sequence was found in the S288c strain. false Isaac Bean annotation2523764 1 FUS1 range2523764 1 1 201 BBa_K2111002_sequence 1 tttggtgcgatgatgaaacaaacatgaaacgtctgtaatttgaaacaaataacgtaattctcgggattggttttatttaaatgacaatgtaagagtggctttgtaaggtatgtgttgctcttaaaatatttggatacgacatcctttatcttttttcctttaagagcaggatataagccatcaagtttctgaaaatcaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z