BBa_K2111005 1 BBa_K2111005 FUS1_iLOV 2016-10-18T11:00:00Z 2016-10-19T06:52:40Z We used our FUS1 part (BBa_K2111002) and iLOV (BBa_K660004) from the 2011 Glasgow iGEM team. This is a composite of the FUS1 promoter (BBa_K2111002) and iLOV (BBa_K660004). It is a reporter part used to visualize activation of the yeast mating pathway. false false _2579_ 31485 31485 9 false We used these parts to obtain a visible visible reporter. false Isaac Bean component2523777 1 BBa_K2111002 component2523779 1 BBa_K660004 annotation2523779 1 BBa_K660004 range2523779 1 208 543 annotation2523777 1 BBa_K2111002 range2523777 1 1 201 BBa_K2111002 1 BBa_K2111002 FUS1 Promoter 2016-10-18T11:00:00Z 2016-10-19T06:59:22Z We used the sequence from BBa_K775004, with confirmation from the NCBI database for use in yeast strain S288c. The FUS1 promoter is from the yeast mating pathway. It is induced with pheromones from the opposite mating type. false false _2579_ 31485 31485 9 Not in stock false We confirmed that the sequence was found in the S288c strain. false Isaac Bean annotation2523764 1 FUS1 range2523764 1 1 201 BBa_K660004 1 BBa_K660004 iLOV 2011-09-15T11:00:00Z 2015-05-08T01:13:03Z iLOV is a version of LOV2 that has been altered through site directed mutagenesis and DNA shuffling. Released HQ 2013 iLOV has the same function and uses as LOV2. As a reporter, it is advantageous over GFP derived fluorescent proteins due to its small size (useful if you are tagging proteins), ability to recover quickly from photobleaching and use in anoxic conditions. false false _837_ 0 9421 9 In stock true illegal restriction sites. The part was synthesized to remove them. false Glasgow Uni 2011 annotation2135615 1 iLOV Domain range2135615 1 1 336 BBa_K2111005_sequence 1 tttggtgcgatgatgaaacaaacatgaaacgtctgtaatttgaaacaaataacgtaattctcgggattggttttatttaaatgacaatgtaagagtggctttgtaaggtatgtgttgctcttaaaatatttggatacgacatcctttatcttttttcctttaagagcaggatataagccatcaagtttctgaaaatcaaaatactagatgattgaaaaaaactttgtgattaccgatccgcgtctgccggataacccgattatttttgcgagcgatggctttctggaactgaccgaatatagccgtgaagaaattctgggccgtaacgcgcgttttttgcagggcccggaaaccgatcaggcgaccgtgcagaaaattcgtgatgcgattcgtgatcagcgtgaaaccaccgtgcagctgattaactataccaaaagcggcaaaaaattttggaacctgctgcatttgcagccggtgcgtgatcagaaaggcgaattgcagtattttattggcgtgcagctggatggcagcgatcatgtgtaa BBa_K660004_sequence 1 atgattgaaaaaaactttgtgattaccgatccgcgtctgccggataacccgattatttttgcgagcgatggctttctggaactgaccgaatatagccgtgaagaaattctgggccgtaacgcgcgttttttgcagggcccggaaaccgatcaggcgaccgtgcagaaaattcgtgatgcgattcgtgatcagcgtgaaaccaccgtgcagctgattaactataccaaaagcggcaaaaaattttggaacctgctgcatttgcagccggtgcgtgatcagaaaggcgaattgcagtattttattggcgtgcagctggatggcagcgatcatgtgtaa BBa_K2111002_sequence 1 tttggtgcgatgatgaaacaaacatgaaacgtctgtaatttgaaacaaataacgtaattctcgggattggttttatttaaatgacaatgtaagagtggctttgtaaggtatgtgttgctcttaaaatatttggatacgacatcctttatcttttttcctttaagagcaggatataagccatcaagtttctgaaaatcaaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z