BBa_K2112011 1 BBa_K2112011 Fragment 1 2016-10-13T11:00:00Z 2016-10-14T08:05:06Z From other plasmid. T7 promoter is a strong promoter to launch the transcription procedure. Lac operator DNA sequence could bind a protein named LacI coded by a lacI DNA sequence which located in another plasmid. This process stop the transcription of the target gene (opdA). So in our study, we add a compound named IPTG to the culture medium. IPTG could bind LacI protein, so that the structure of LacI will be changed and could not bind to lac operator DNA sequence any more. And the target gene opdA could be transcribed and translated. His-tag sequence (fused in N-terminal of target protein OpdA) consisted of five to six histidines, which could bind to Nickel metal ions. So with a special resin chelated with nickel metal ions, we can purify the expressed OpdA protein easily. false false _2580_ 27358 27358 9 false Adding five additional amino acid behind His-tag to ensure a distance exists between His-tag and the target protein so that the protein can work better. false Fanglin Zhao BBa_K2112011_sequence 1 gaattccgatcccgcgaaattaatacgactcactataggggaattgtgagcggataacaattcccctctagaaataattttgtttaactttaagaaggagatataccatgggcagcagccatcatcatcatcatcacagcagcggcaagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z