BBa_K2113000 1 BBa_K2113000 RNAt_AMPgg 2016-10-04T11:00:00Z 2016-10-05T06:57:07Z cjBlue chromoprotein is from the Cnidopus japonicus sea anemone. RNA thermometer is from Bradirhizobium japonicum. The antimicrobial peptide is synthetically designed. This part codes for an antimicrobial peptide consisting of 3 sets of alternating tryptophan and arginine preceded by two glycine residues. The gene sequence for this peptide is followed by a gene for cjBlue, green chromoprotein and a double terminator. This entire part is under the regulation of an RNA thermometer ROSE that allows translation of the genes downstream only above 42??C. true false _2581_ 27883 27883 9 false The stability of the antimicrobial peptide. We added glycine to increase the peptide's half life. false Saishreyas Gourishankar Iyer annotation2486035 1 conserved range2486035 1 48 51 annotation2486045 1 BBa_K592011 range2486045 1 166 867 annotation2486039 1 Predicted Stem Loop range2486039 1 102 134 annotation2486034 1 BBa_B0034 range2486034 1 44 55 annotation2486041 1 Biobrick-Scar-adaptation range2486041 1 137 142 annotation2486040 1 Predicted Stem Loop extending to startcodon range2486040 1 135 159 annotation2486043 1 BBa_K115001 range2486043 1 64 159 annotation2486038 1 Predicted Stem Loop range2486038 1 79 99 annotation2486037 1 Predicted Stem Loop range2486037 1 64 78 annotation2486052 1 stem_loop range2486052 1 937 959 annotation2486047 1 BBa_B0014 range2486047 1 876 970 annotation2486049 1 polya range2486049 1 903 916 annotation2486044 1 cjBlue range2486044 1 166 864 annotation2486050 1 stop range2486050 1 909 909 annotation2486053 1 BBa_K823017 range2486053 1 876 970 annotation2486036 1 BBa_K608002 range2486036 1 1 55 annotation2486048 1 T7 TE range2486048 1 883 902 annotation2486046 1 BBa_B0012 range2486046 1 876 916 annotation2486051 1 BBa_B0011 range2486051 1 925 970 annotation2486042 1 SD range2486042 1 153 158 annotation2486033 1 BBa_J23104 range2486033 1 1 35 BBa_K2113000_sequence 1 tgccacctgacgtctaagaagaattcgcggccgcttctagagttgacggctagctcagtcctaggtatagtgctagcgccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggattactagatgggcggctggcgttggcgttggcgttaaaaagaggagaaatactagatggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataatcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattttactagtagcggccgctgcaggctcactcaaaggcggtaat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z