BBa_K592011 1 cjBlue cjBlue, green chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:49Z Cnidopus japonicus This chromoprotein, cjBlue, naturally exhibits strong green/blue color when expressed. Compared to amilCP(BBa_K592009) and amilGFP(BBa_K592010), the color development is slower. On agar plates and in liquid culture, the color is readily visible to naked eye after 24-48 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _763_ 0 7929 9 In stock false Codon-optimization for expression in E.coli necessary. false Antonio Ascue Avalos annotation2131787 1 cjBlue range2131787 1 1 699 BBa_K2113001 1 BBa_K2113001 RNA thermometer + cjBlue 2016-10-12T11:00:00Z 2016-10-14T12:42:07Z The part RNA thermometer was isolated from Bradyrhizobium japonicum.We obtained the parts from the 2016 distribution kit. This is a part that contains RNA thermometer (BBa_K115001) which is a temperature sensitive device that initiates translation above 42 degree celcius.Following the RNA thermometer,the construct contains the part BBa_K592011 coding cjBlue protein as the reporter.This part could be used to construct a efficient temperature regulated system with various promoters. false false _2581_ 25971 25971 9 false nil false SVCE_CHENNAI component2500496 1 BBa_K115001 component2500498 1 BBa_K592011 annotation2500496 1 BBa_K115001 range2500496 1 1 96 annotation2500498 1 BBa_K592011 range2500498 1 103 804 BBa_K115001 1 BBa_K115001 RNA thermometer (ROSE) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein (prfA). Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966896 1 SD range1966896 1 90 95 annotation1966898 1 Biobrick-Scar-adaptation range1966898 1 74 79 annotation1966928 1 Predicted Stem Loop range1966928 1 39 71 annotation1966927 1 Predicted Stem Loop range1966927 1 16 36 annotation1966929 1 Predicted Stem Loop extending to startcodon range1966929 1 72 96 annotation1966926 1 Predicted Stem Loop range1966926 1 1 15 BBa_K115001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat BBa_K2113001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggattactagatggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa BBa_K592011_sequence 1 atggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z