BBa_K2113009 1 BBa_K2113009 RNA thermometer and AMP without glycine 2016-10-13T11:00:00Z 2016-10-14T03:19:26Z 2016 distribution kit This construct consists of RNA thermometer (BBa_K115001) regulated by a strong promoter (BBa_J23119).It is followed by the part (BBa_K2113004) antimicrobial peptide sequence without glycine.Gfp is used as a reporter protein (BBa_E0040).And the part (BBa_K823017) is used as a double terminator. false false _2581_ 25972 25972 9 false nil false SVCE_CHENNAI component2501475 1 BBa_K2113004 component2501474 1 BBa_K115001 component2501467 1 BBa_J23119 component2501477 1 BBa_B0034 component2501487 1 BBa_K823017 component2501479 1 BBa_K592011 annotation2501487 1 BBa_K823017 range2501487 1 906 1000 annotation2501467 1 BBa_J23119 range2501467 1 1 35 annotation2501475 1 BBa_K2113004 range2501475 1 146 169 annotation2501474 1 BBa_K115001 range2501474 1 44 139 annotation2501477 1 BBa_B0034 range2501477 1 178 189 annotation2501479 1 BBa_K592011 range2501479 1 196 897 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation7019 1 BBa_B0011 range7019 1 1 46 annotation1683 1 stem_loop range1683 1 13 35 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K2113004 1 BBa_K2113004 AMP without glycine 2016-10-13T11:00:00Z 2016-10-14T12:43:35Z nil It consists of cationic anti-microbial peptides (AMP) with consecutive sequences of arginine and tryptophan (WRWRWR).This can be used as an antimicrobial agent against a wide range of gram positive and gram negative bacteria. false false _2581_ 25971 25972 9 false nil false SVCE_CHENNAI BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_J23119 1 BBa_J23119 constitutive promoter family member 2006-08-23T11:00:00Z 2015-08-31T04:08:40Z Overlap extension of synthetic oligonucleotides Released HQ 2013 Later false true _52_ 0 483 95 In stock false N/A true John Anderson BBa_K592011 1 cjBlue cjBlue, green chromoprotein 2011-09-17T11:00:00Z 2015-05-08T01:12:49Z Cnidopus japonicus This chromoprotein, cjBlue, naturally exhibits strong green/blue color when expressed. Compared to amilCP(BBa_K592009) and amilGFP(BBa_K592010), the color development is slower. On agar plates and in liquid culture, the color is readily visible to naked eye after 24-48 hours of incubation. The DNA was codon-optimized for expression in E.coli and synthesized by the Korean company Bioneer Corporation. false false _763_ 0 7929 9 In stock false Codon-optimization for expression in E.coli necessary. false Antonio Ascue Avalos annotation2131787 1 cjBlue range2131787 1 1 699 BBa_K823017 1 BBa_K823017 double terminator (B0012-B0011) 2012-09-10T11:00:00Z 2015-05-08T01:13:30Z Part:BBa_B0014 Released HQ 2013 This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false false _1081_ 0 11555 9 In stock false This is a copy of the [[Part:B0014|Part:B0014]]. Only here the part is cloned in the standard vector pSB1C3 instead of the pSB1AK3. false Jara Radeck component2182657 1 BBa_B0014 annotation2182657 1 BBa_B0014 range2182657 1 1 95 BBa_K115001 1 BBa_K115001 RNA thermometer (ROSE) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Bradirhizobium Japonicum (BA000040.) as the 5'UTR (ROSE) of a heat shock protein (prfA). Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1966926 1 Predicted Stem Loop range1966926 1 1 15 annotation1966927 1 Predicted Stem Loop range1966927 1 16 36 annotation1966898 1 Biobrick-Scar-adaptation range1966898 1 74 79 annotation1966928 1 Predicted Stem Loop range1966928 1 39 71 annotation1966929 1 Predicted Stem Loop extending to startcodon range1966929 1 72 96 annotation1966896 1 SD range1966896 1 90 95 BBa_K2113009_sequence 1 ttgacagctagctcagtcctaggtataatgctagctactagaggccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggattactagatgtggcgttggcgttggcgttaatactagagaaagaggagaaatactagatggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0034_sequence 1 aaagaggagaaa BBa_K115001_sequence 1 gccgcgacaagcggtccgggcgccctaggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtcaagttcttgctccttggaggat BBa_K823017_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_K592011_sequence 1 atggcttccaaaataagcgacaacgtacgtatcaaactgtatatggagggcacggttaataatcaccacttcatgtgtgaagcggagggtgagggcaagccatacgaaggaacgcagatggaaaacattaaagtgaccaaaggaggcccgctgccgttctcttttgatatcctgacgccgaactgccaatatggttctgtagccataaccaagtacacgtcggggattccggactattttaaacagtcattccctgaaggttttacctgggaaagaaccaccatttatgaagatggggcttatctgacaactcagcaggaaaccaaacttgatggaaattgcttagtctacaatattaaaatcctcggctgcaattttccccccaatggtcctgttatgcagaaaaaaacgcaaggctgggaaccatgttgcgagatgcgctatacacgtgatggtgtcttgtgcggtcagacattaatggcactgaaatgtgccgatgggaaccatctgacttgtcatctgcggactacttaccgatccaaaaaggcagcgaaggcgttgcaaatgccacctttccatttttcagaccatcgtccggaaattgtgaaggttagcgagaacggcacactgtttgagcagcacgaaagtagtgtggcacgctattgtcagacatgcccgagcaaacttggtcataattaataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23119_sequence 1 ttgacagctagctcagtcctaggtataatgctagc BBa_K2113004_sequence 1 atgtggcgttggcgttggcgttaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z